# US 2020/0399712 A1 · Compositions and methods for the diagnosis and detection of tumors and cancer prognosis

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2020/0399712 A1
- Document ID: US20200399712A1
- Status: Published application
- Kind: A1
- Application number: 17/011,732
- Filed: 2020-09-03
- Published: 2020-12-24
- Earliest claimed: 2018-03-06
- Applicants: The Regents of the University of California
- Inventors: Joseph Califano
- Web page: https://patentgrep.com/patent/US20200399712A1

## CPC

- C12Q 1/6886: for cancer (immunoassay for cancer G01N33/575)
- C12Q 1/708: {for papilloma}
- C12Q 2600/106: Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
- C12Q 2600/118: Prognosis of disease development
- C12Q: MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS (immunoassay G01N33/53); COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES

## Abstract

Provided herein are probe and primer pairs that are useful for the detection of HPV in samples isolated from patients.

## Claims

### Claim 1

A method for treating an HPV-related cancer in a patient, the patient having been selected for the treatment by detection of one or more of HPV E2, E4 or E5 in a sample isolated from the patient, the method comprising administering an effective amount of one or more of: FGFR inhibitor AZD4547, radiotherapy, or cisplatin optionally with cetuximab, thereby treating the patient.

### Claim 2 (depends on 1)

The method of claim 1, where the patient sample is negative for E6 and E7.

### Claim 3 (depends on 1)

The method of claim 1, further comprising detecting one or more of HPV E1, E2, E4, E5, E6 or E7 by contacting the isolated sample with a probe and primer pair of any one of:
a probe and primer pair detecting E1 selected from:
1. a forward primer comprising the sequence: GCACAATTGGCAGACACTAAT, or an equivalent thereof,
2. a reverse primer comprising the sequence: GCACAATCCTTTACAATTTTTGCC, or an equivalent thereof, and
3. a probe comprising the sequence: AGTAATGCAAGTGCCTTTCTAAAAAGTAATTC, or an equivalent thereof,
a probe and primer pair detecting E1 selected from:
a) a forward primer comprising the sequence: GCAAAACGCACAAAACGTGC, or an equivalent thereof,
b) a reverse primer comprising the sequence: GACATGTACCTGCCTGTTTGC, or an equivalent thereof, and
c) a probe comprising the sequence: CGGCTACCCAACTTTATAAAACA, or an equivalent thereof,
a probe and primer pair detecting one or more of HPV E1, E2, E4, E5, E6 or E7 comprising a sequence selected from those listed in Table 1 or an equivalent of each thereof,
a probe and primer pair that detects one of HPV E4 or an equivalent of each thereof, and/or
a probe and primer pair that detects one of HPV E5 or an equivalent of each thereof,
under suitable conditions for detection of any HPV in the sample, and detecting any one of HPV E1, E2, E4, E5, E6 or E7 and, optionally, not detecting any one of HPV E6 or E7 in the sample.

### Claim 4 (depends on 1)

The method of claim 1, wherein the one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5 is selected from Table 1.

### Claim 5 (depends on 1)

The method of claim 1, wherein the sample is one or more of saliva, blood, plasma, or a tumor sample.

### Claim 6 (depends on 1)

The method of claim 1, wherein the patient is a human patient.

### Claim 7 (depends on 1)

The method of claim 1, wherein the HPV-related cancer is one or more of HPV-related head and neck squamous cell carcinoma (HNSCC), HPV 16, cancer of the oropharynx, cancer of the pharyngeal, cancer of the cervix, cancer of the vulva, cancer of the penis, cancer of the anus, or cancer of the larynx.

### Claim 8

A probe and primer pair, comprising:
a) a forward primer comprising the sequence: GCACAATTGGCAGACACTAAT, or an equivalent thereof,
a reverse primer comprising the sequence: GCACAATCCTTTACAATTTTTGCC, or an equivalent thereof, and
a probe comprising the sequence: AGTAATGCAAGTGCCTTTCTAAAAAGTAATTC, or an equivalent thereof, or
b) a forward primer comprising the sequence: GCAAAACGCACAAAACGTGC, or an equivalent thereof,
a reverse primer comprising the sequence: GACATGTACCTGCCTGTTTGC, or an equivalent thereof, and
a probe comprising the sequence: CGGCTACCCAACTTTATAAAACA, or an equivalent thereof.

### Claim 9 (depends on 8)

The probe and primer pair of claim 8, further comprising a detectable label on one or more of the forward primer, the reverse primer, or the probe.

### Claim 10 (depends on 8)

A method for detecting Human Papilloma Virus (HPV) in a sample comprising contacting the sample with the probe and primer pair of claim 8 and, optionally, one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5, under suitable conditions for detection of the HPV, and detecting any HPV in the sample.

### Claim 11 (depends on 10)

The method of claim 10, wherein the one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5 is selected from Table 1.

### Claim 12 (depends on 10)

The method of claim 10, wherein the sample is one or more of saliva, blood, plasma, or a tumor sample.

### Claim 13 (depends on 8)

A method for detecting Human Papilloma Virus (HPV)-related cancers in a sample comprising contacting the sample with the probe or primer pair of claim 8 and, optionally, one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5, under suitable conditions for detection of the HPV, and detecting any HPV in the sample.

### Claim 14 (depends on 13)

The method of claim 13, wherein the one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5 is selected from Table 1.

### Claim 15 (depends on 13)

The method of claim 13, wherein the sample is one or more of saliva, blood, plasma, or a tumor sample.

### Claim 16 (depends on 8)

A method for monitoring disease progression in a cancer patient in remission from an HPV-related cancer, comprising contacting a sample isolated from the patient with the probe and primer pair of claim 8 and, optionally, one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5, under suitable conditions for detection of any HPV in the sample, and detecting any HPV in the sample.

### Claim 17 (depends on 8)

A method for predicting likelihood of clinical outcome or disease recurrence in a cancer patient, comprising contacting a sample isolated from the patient with the probe and primer pair of claim 8 and, optionally, one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5, under suitable conditions for detection of any HPV in the sample, and detecting any HPV in the sample.

### Claim 18 (depends on 16)

The method of claim 16, wherein the one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5 is selected from Table 1.

### Claim 19 (depends on 16)

The method of claim 16, wherein the sample is one or more of saliva, blood, plasma, or a tumor sample.

### Claim 20 (depends on 8)

A method of determining whether a cancer patient will benefit from treatment with FGFR inhibitor AZD4547, comprising contacting a sample isolated from the patient with the probe and primer pair of claim 8 and, optionally, one or more of (i) a probe and primer pair that detects one of HPV E2, (ii) a probe and primer pair that detects one of HPV E4, and (iii) a probe and primer pair that detects one of HPV E5, under suitable conditions for detection of any HPV in the sample, and detecting any one of HPV E2, E4, or E5 and, optionally, not detecting any one of HPV E6 or E7 in the sample, wherein such detection indicates a cancer patient will benefit from treatment with FGFR inhibitor AZD4547.