# US 2019/0167710 A1 · Methods of Treating Conditions Involving Elevated Inflammatory Response

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2019/0167710 A1
- Document ID: US20190167710A1
- Status: Published application
- Kind: A1
- Application number: 16/209,206
- Filed: 2018-12-04
- Published: 2019-06-06
- Earliest claimed: 2017-12-04
- Assignees: University of Pittsburgh—Of the Commonwealth System of Higher Education
- Applicants: University of Pittsburgh - Of the Commonwealth System of Higher Education
- Inventors: Daolin Tang; Timothy Billiar; Ling Zeng
- Web page: https://patentgrep.com/patent/US20190167710A1

## CPC

- A61K 31/7105: Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
- A61K 31/439: the ring forming part of a bridged ring system, e.g. quinuclidine (8-azabicyclo [3.2.1] octanes A61K31/46)
- A61K 31/506: not condensed and containing further heterocyclic rings
- A61K 31/675: having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
- A61P 37/06: Immunosuppressants, e.g. drugs for graft rejection
- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- C12N 15/1136: {against growth factors, growth regulators, cytokines, lymphokines or hormones}
- C12N 2310/14: interfering nucleic acids [NA]
- C12N 2320/30: Special therapeutic applications
- Y02A 50/30: Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- Y02A: TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE

## Abstract

A method of treating a patient having an elevated inflammatory response, such as an elevated Type I interferon response, is provided. The method can be used to treat sepsis. The method comprises administering to a patient having an elevated inflammatory response, an inhibitor of anaplastic lymphoma kinase (ALK inhibitors) or expression of ALK, in an amount effective to treat the elevated inflammatory response.

## Claims

### Claim 1

A method of reducing a type I interferon (IFN) response in a patient having an inflammatory disease, comprising administering to the patient an amount of an ALK inhibitor or an inhibitor of ALK expression effective to reduce a type I interferon response in a patient.

### Claim 2 (depends on 1)

The method of claim 1, wherein the administration to the patient of the ALK inhibitor or inhibitor of ALK expression is effective to decrease a type I IFN response in the patient.

### Claim 3 (depends on 1)

The method of claim 1, comprising administering to the patient an amount of an ALK inhibitor effective to decrease production of a type I IFN in a patient.

### Claim 4 (depends on 3)

The method of claim 3, wherein the ALK inhibitor is LDK378, crizotinib, alectinib, AP26113, ASP3026, or TSR-011, or a pharmaceutically acceptable salt of any of the preceding.

### Claim 5 (depends on 3)

The method of claim 3, wherein the ALK inhibitor is Ruxolitinib (INCB018424); Toremifene Citrate; Sal003; PAC-1; Embelin; E-64; Cryptotanshinone; Apoptosis Activator 2; AVL-292; PF-5274857; CGI1746; (−)-Parthenolide; Pifithrin-μ; Bazedoxifene HCl; CP-91149; PP2; OSI-420; ZM 306416; Dalcetrapib (JTT-705 (RO4607381); Wnt-059 (C59); AT101; (+)-JQ1; GW0742; PNU-120596; WZ4003; NH125; Ozagrel; Daunorubicin HCl; Isotretinoin; ICG-001; Ospemifene; AZ 3146; Stattic; LDK378; PRT062607 HCl; KU-60019; AZD3463; or KPT-330, or a pharmaceutically acceptable salt of any of the preceding.

### Claim 6 (depends on 1)

The method of claim 1, wherein the ALK inhibitor is LDK378, or a pharmaceutically acceptable salt thereof.

### Claim 7 (depends on 1)

The method of claim 1, wherein the ALK inhibitor is lorlatinib, or a pharmaceutically acceptable salt thereof.

### Claim 8 (depends on 1)

The method of claim 1, wherein the ALK inhibitor is AP26113, or a pharmaceutically acceptable salt thereof.

### Claim 9 (depends on 1)

The method of claim 1, wherein the type I interferon response is a stimulator of interferon genes (STING) response.

### Claim 10 (depends on 1)

The method of claim 1, wherein the inflammatory disease or condition is:
systemic inflammatory response syndrome; meningococcemia; trauma hemorrhage; ionizing radiation exposure; acute pancreatitis; adult respiratory distress syndrome (ARDS); reperfusion injury, which includes: post-pump syndrome or ischemia-reperfusion injury; cardiovascular disease, which includes: cardiac stun syndrome, myocardial infarction, or congestive heart failure; infectious disease, which includes: hiv infection/hiv neuropathy, meningitis, hepatitis, septic arthritis, peritonitis, pneumonia epiglottitis, or E. coli 0157:H7; hemolytic uremic syndromic/thrombolytic thrombocytopenic purpura; malaria; dengue hemorrhagic fever; leishmaniasis; leprosy; toxic shock syndrome; streptococcal myositis; gas gangrene; Mycobacterium tuberculosis; Mycobacterium avium intracellulare; Pneumocystis carinii pneumonia; pelvic inflammatory disease; orchitis/epidydimitis; Legionella; lyme disease; influenza A; Epstein-Barr virus; viral associated hemiaphagocytic syndrome; viral encephalitis/aseptic meningitis; obstetric or gynecological conditions, including: premature labor, miscarriage, or infertility; inflammatory disease or autoimmune conditions, which includes: rheumatoid arthritis/seronegative arthropathies, osteoarthritis, inflammatory bowel disease, systemic lupus erythematosis, iridoeyelitis/uveitistoptic neuritis, idiopathic pulmonary fibrosis, systemic vasculitis/Wegener's gramilornatosis, sarcoidosis, or orchitis/vasectomy reversal procedures; allergic/atopic diseases, which includes: asthma, allergic rhinitis, eczema, allergic contact dermatitis, allergic conjunctivitis, or hypersensitivity pneumonitis; transplant-related conditions, including: organ transplant rejection or graft-versus-host disease; cachexia; congenital conditions, which include: cystic fibrosis, familial hematophagocytic lymphohistiocytosis or sickle cell anemia; dermatologic conditions, which includes: psoriasis and alopecia; neurologic, which includes: multiple sclerosis and migraine headache; renal conditions, which includes: nephrotic syndrome, hermodialysis, and uremia; toxicity, which includes: OKT3 therapy, anti-CD3 therapy, cytokine therapy, chemotherapy, radiation therapy, or chronic salicylate intoxication; or metabolic/idiopathic conditions, which include: wilson's disease, hemachromatosis, alpha-1 antitrypsin deficiency, diabetes, Hashimoto's thyroiditis, osteoporosis, hypothalamic-pituitary-adrenal axis evaluation, or primary biliary cirrhosis.

### Claim 11 (depends on 1)

The method of claim 1, wherein the inflammatory disease is inflammation associated with an infectious disease.

### Claim 12 (depends on 1)

The method of claim 1, wherein the inflammatory disease is systemic inflammatory response syndrome.

### Claim 13 (depends on 12)

The method of claim 12, wherein the systemic inflammatory response syndrome is gram positive sepsis, gram negative sepsis, culture negative sepsis, fungal sepsis, neutropenic fever, or urosepsis sepsis.

### Claim 14 (depends on 1)

The method of claim 1, wherein the inflammatory disease is sepsis.

### Claim 15 (depends on 1)

The method of claim 1, wherein the inflammatory disease is inflammation associated with a viral disease.

### Claim 16 (depends on 13)

The method of claim 13, wherein the inflammation associated with a viral disease is lung inflammation associated with influenza.

### Claim 17 (depends on 1)

The method of claim 1, comprising administering to the patient and amount of an RNAi agent or an antisense agent effective to reduce a type I interferon response in a patient.

### Claim 18 (depends on 17)

The method of claim 17, wherein the RNAi agent is a shRNA, such as
CCGGGTGATAAATACAAGGCCCAGACTCGAGTCTGGGCCTTGTATTTATC
ACTTTTT,
or
CCGGAGAAGAAGAAATCCG TGTGAACTCGAGTTCACACGGATTTCTTCT
TCTTTTTT.

### Claim 19

A method of treating an inflammatory disease in a patient, comprising administering to the patient an amount of an ALK inhibitor or an inhibitor of ALK expression effective to treat the inflammatory disease in a patient.

### Claim 20 (depends on 19)

The method of claim 19, comprising administering to the patient an amount of an ALK inhibitor or an inhibitor of ALK expression effective to reduce a type I interferon (IFN) response or a stimulator of interferon genes (STING) response in a patient.

### Claim 21

A method of improving a patient's health-span or life-span, comprising administering to the patient an amount of an ALK inhibitor or an inhibitor of ALK expression effective to decrease a type I interferon (IFN) response or a stimulator of interferon genes (STING) response in a patient.

### Claim 22 (depends on 21)

The method of claim 21, wherein the improvement in health-span or life-span follows recovery from an inflammatory disease or condition in a patient, and the compound is administered after recovery from the inflammatory disease or condition.