Back to results
US 2019/0100799 A1Published application
Compositions and methods of detecting myelitis
AssigneeMichael Levy
InventorMichael Levy
Life of this patent
Estimating the term…
Abstract
The present invention relates to novel compositions and methods for detecting myelitis. The invention also relates to methods of identifying mutations in VPS37a indicative of monophasic acute transverse myelitis.
Claims7
A method of diagnosing myelitis, comprising:
- obtaining a sample from a subject;
- amplifying a region of a VPS37a gene with a first primer and a second primer, wherein the first primer has the sequence aaggcagtgtgagatgtgaaga (SEQ ID NO:
- 1), fragments or variants thereof, and the second primer has the sequence tcccactaaggcaacaacaa (SEQ ID NO:
- 2) fragments or variants thereof;
- sequencing the amplified sequence;
- and
- identifying a leucine to isoleucine change at amino acid position 234.
4 more elements
A isolated nucleic acid sequence comprising SEQ ID NO:
- 1, SEQ ID NO:
- 2, fragments or variants thereof.
A composition comprising a nucleic acid sequence comprising SEQ ID NOS:
- 1, 2, fragments or variants thereof.
Dependencies are inferred from the claim text.