Rhizobacterial strain and uses for enhancing total lipid yields in an oilseed crop
OwnerMartin FILION, Marc SURETTEinventors
Life of this patent
Estimating the term…
Abstract
There is described an isolated rhizobacterial strain for enhancing total lipid yields in an oilseed crop having a nucleic acid molecule comprising a nucleotide sequence consisting of SEQ ID NO.:1; or the nucleotide sequence SEQ ID NO.:1 having a substitution, a deletion and/or an addition of one or more nucleotide; or a nucleotide sequence having sufficient homology with the nucleotide sequence SEQ ID NO.:1 for enhancing total lipid yields, or a nucleotide sequence capable of hybridization with a first primer consisting of SEQ ID NO.:2; and/or a second primer consisting of SEQ ID NO.:3; and/or a nucleotide sequence capable of hybridization with a probe consisting of SEQ ID NO.:4; and variants thereof.
Claims9
-13. (canceled)
A method for enhancing total lipid yields in oilseed crop, comprising a step of inoculating the oilseed crop with a Pseudomonas fluorescens strain deposited under ATCC Patent Deposit Designation No. PTA-123874 filed on Mar. 9, 2017 at a quantity of at least 1×107 to 1×109 bacterial cells/plant, the Pseudomonas fluorescens strain having a nucleic acid molecule comprising a nucleotide sequence consisting of:
- (SEQ ID NO.:
- 5)
- 5′CTACGGCAAGGCGACGCTGACGTGTGCAAAGGTTGTACCCGTTTCAC
- CACATCAGCCGGCTGCGCCTGCATCGCGGTCTTGATCATAGACTCGGAA
- TTGTCCGCGCCAATGATCACCCGATTGGGTTTTTCCGCCAGCAACGGCC
- AGAAACGCCCTGCACCACACGGCAGATCCAGAACCAGCCCCGGCTCGCC
- CGTCAGCGTCGCCTTGCCGTAG3′,
- wherein the Pseudomonas fluorescens strain is in association with a biologically acceptable carrier;
- and
- wherein the Pseudomonas fluorescens strain increases total lipid yields in the oilseed crop relative to oilseed crop not exposed to the Pseudomonas fluorescens strain.
-17. (canceled)
(canceled)
Dependencies are inferred from the claim text.