Methods and compositions for treating malignant tumors associated with kras mutation
AssigneeNitto Denko Corporation
InventorsKenjirou Minomi, Jihua Liu, Li Wang, Bharat Majeti, Roger Adami, Wenbin Ying
Life of this patent
Estimating the term…
Abstract
This invention provides methods and compositions for preventing, treating or ameliorating one or more symptoms of a malignant tumor, which may be associated with KRAS mutation in a mammal in need thereof, by administering to the mammal a therapeutically effective amount of a composition comprising one or more RNAi molecules that are active in reducing expression of GST-π.
Claims22
A pharmaceutical composition for the treatment or therapy of a malignant tumor, the composition comprising RNAi molecules and pharmaceutically acceptable excipients, wherein the RNAi molecules comprise a sense strand which comprises CCUUUUGAGACCCUGCUGUUU (SEQ ID NO:294) and an antisense strand which comprises ACAgCaGgGUCUCAAAAGGUU (SEQ ID NO:298), or wherein the RNAi molecules comprise a sense strand which comprises GGAUGACUAUGUGAAGGCAUU (SEQ ID NO:303) and an antisense strand which comprises UGCcUuCaCAUAGUCAUCCUU (SEQ ID NO:305), wherein an uppercase letter refers to an unmodified ribonucleotide, wherein a lower case letter refers to 2′-deoxy, and wherein the underlined nucleotides are 2′-OMe-substituted.
A method for preventing, treating or ameliorating one or more symptoms of a malignant tumor associated with KRAS mutation in a mammal in need thereof, the method comprising:
- identifying a tumor cell in the mammal, the tumor cell comprising at least one of:
- (i) a mutation of the KRAS gene, and (ii) an aberrant expression level of KRAS protein;
- and
- administering to the mammal a therapeutically effective amount of a composition comprising one or more RNAi molecules that are active in reducing expression of GST-π;
- wherein the RNAi molecules comprise a sense strand which comprises CCUUUUGAGACCCUGCUGUUU (SEQ ID NO:294) and an antisense strand which comprises ACAgCaGgGUCUCAAAAGGUU (SEQ ID NO:298), or wherein the RNAi molecules comprise a sense strand which comprises GGAUGACUAUGUGAAGGCAUU (SEQ ID NO:303) and an antisense strand which comprises UGCcUuCaCAUAGUCAUCCUU (SEQ ID NO:305), wherein an uppercase letter refers to an unmodified ribonucleotide, wherein a lower case letter refers to 2′-deoxy, and wherein the underlined nucleotides are 2′-OMe-substituted.
An RNAi molecule comprising a sense strand which comprises CCUUUUGAGACCCUGCUGUUU (SEQ ID NO:294) and an antisense strand which comprises ACAgCaGgGUCUCAAAAGGUU (SEQ ID NO:298), wherein an uppercase letter refers to an unmodified ribonucleotide, wherein a lower case letter refers to 2′-deoxy, and wherein the underlined nucleotides are 2′-OMe-substituted.
An RNAi molecule comprising a sense strand which comprises GGAUGACUAUGUGAAGGCAUU (SEQ ID NO:303) and an antisense strand which comprises UGCcUuCaCAUAGUCAUCCUU (SEQ ID NO:305), wherein an uppercase letter refers to an unmodified ribonucleotide, wherein a lower case letter refers to 2′-deoxy, and wherein the underlined nucleotides are 2′-OMe-substituted.
Dependencies are inferred from the claim text.