Antisense oligonucleotides for modulating htra1 expression
AssigneeHoffmann-La Roche Inc.
InventorsRoberto Iacone, Peter Hagedorn, Susanne Kammler, Soren Ottosen, Sindri Traustason, Heidi Hudlebusch, Lykke Pedersen
Life of this patent
Estimating the term…
Abstract
The present invention relates to antisense oligonucleotides (oligomers) that are complementary to HTRA1, leading to modulation of the expression of HTRA1. Modulation of HTRA1 expression is beneficial for a range of medical disorders, such as macular degeneration, e.g. age-related macular degeneration.
Claims17
An antisense oligonucleotide of 10-30 nucleotides in length, wherein said antisense oligonucleotide targets a HTRA1 nucleic acid and comprises a contiguous nucleotide region of 10-22 nucleotides which are at least 90% such as 100% complementarity to SEQ ID NO 147:
- SEQ ID NO 147:
- 5′ CCAACAACCAGGTAAATATTTG 3′
Dependencies are inferred from the claim text.