RNA Aptamer Specifically Binding to Carcinoembryonic Antigen and Use thereof
AssigneesPosco, Postech Academy-Industry Foundation
InventorsSeong-Wook LEE, Young-Ju Lee, Jin-Sook Jeong
Life of this patent
Estimating the term…
Abstract
Provided are RNA aptamer specifically binding to cancer metastasis-inducing domain of CEA (Carcinoembryonic antigen), a composition for prevention and/or inhibition and/or diagnosis of cancer metastasis containing the same as an active ingredient, and a method of prevention and/or inhibition and/or diagnosis of cancer metastasis using the same.
Claims9
A method for preventing or inhibiting cancer metastasis, comprising administering an RNA aptamer to a patient in need of inhibition of metastasis, wherein the RNA aptamer is binding to a linkage region between N domain and A1 domain of carcinoembryonic antigen (CEA) and comprises continuous 35 or more bases comprising the nucleotide sequence from 9th to 43rd positions of following SEQ ID NO:
- 13:
- <SEQ ID NO:
- 13>
- GCGGAAGCGUGCUGGGCUAGAAUAAUAAUAAGAAAACCAGUACUUUCGU;
- and
- wherein C (cytosine) and U (uracil) in the RNA aptamer is modified by substituting 2′ hydroxyl group with fluoro group.
Dependencies are inferred from the claim text.