# US 2014/0194491 A1 · Modulation of microrna-138 for the treatment of bone loss

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 2014/0194491 A1
- Document ID: US20140194491A1
- Status: Published application
- Kind: A1
- Application number: 14/128,792
- Filed: 2012-06-11
- Published: 2014-07-10
- Earliest claimed: 2011-06-24
- Assignees: Syddansk Universitet
- Inventors: Moustapha Kassem; Basem Abdallah; Hanna Taipaleenmaeki; Sakari Kauppinen; Tilde Eskildsen; Jan Stenvang
- Web page: https://patentgrep.com/patent/US20140194491A1

## CPC

- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- A61K 31/7088: Compounds having three or more nucleosides or nucleotides
- A61P 19/10: for osteoporosis
- C12N 2310/113: targeting other non-coding nucleic acids, e.g. antagomirs
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS

## Abstract

There is provided nucleic acids (mir-138 Antimirs) for use in treating or preventing bone loss in a patient. Also there is provided a method for reducing the levels of endogenous mir-138 in a cell.

## Claims

### Claim 1

Nucleic acid (Antimir) for use in treating or preventing bone loss in a patient, said antimir capable of hybridizing to a mir-138 (AGCUGGUGUUGUGAAUCAGGCCG).

### Claim 2 (depends on 1)

Nucleic acid (Antimir) for use according to claim 1, wherein said nucleic acid comprises less than 50 nucleic acids, such as less than 45 nucleic acids, for example less than 40 nucleic acids, such as less than 35 nucleic acids, for example less than 30 nucleic acids, such as less than 25 nucleic acids, for example less than 20 nucleic acids, such as less than 15 nucleic acids, for example less than 10 nucleic acids, such as less than 8 nucleic acids, for example less than 6 nucleic acids.

### Claim 3 (depends on 1)

Nucleic acid (Antimir) for use according to claim 1, wherein the nucleic acid is selected from the group consisting of SEQ ID NOS 1-11.

### Claim 4 (depends on 1)

Nucleic acid (Antimir) for use according to claim 1, wherein the bone loss is associated with ankylosing spondylitis, renal osteodystrophy, osteoporosis, glucocorticoid-induced osteoporosis, Paget's disease, abnormally increased bone turnover, periodontitis, bone fractures, rheumatoid arthritis, osteoarthritis, periprosthetic osteolysis, osteogenesis imperfecta, metastatic bone disease, hypercalcemia of malignancy, multiple myeloma, bone loss associated with microgravity, Langerhan's Cell Histiocytosis (LHC), or bone loss associated with renal tubular disorders, or bone loss associated with bed-ridden conditions.

### Claim 5 (depends on 1)

Nucleic acid (Antimir) for use according to claim 1, wherein the bone loss is associated with osteoporosis.

### Claim 6

A method for reducing the levels of endogenous mir-138 in a cell, said method comprising the introduction of the nucleic acid and/or the vector according to the present invention into a cell in an amount sufficient to reduce the levels of said mir-138.

### Claim 7 (depends on 6)

The method of claim 6, wherein the one or more nucleic acids are selected from the group consisting of SEQ ID NOS 1-11.

### Claim 8

A method for treating or preventing bone loss in a patient comprising the steps of providing one or more nucleic acids (Antimir) capable of hybridizing to a mir-138, and administering said one or more nucleic acids to the patient.

### Claim 9 (depends on 8)

The method according to claim 8, wherein said one or more nucleic acids comprises less than 50 nucleic acids, such as less than 45 nucleic acids, for example less than 40 nucleic acids, such as less than 35 nucleic acids, for example less than 30 nucleic acids, such as less than 25 nucleic acids, for example less than 20 nucleic acids, such as less than 15 nucleic acids, for example less than 10 nucleic acids, such as less than 8 nucleic acids, for example less than 6 nucleic acids.

### Claim 10 (depends on 8)

The method of claim 8, wherein the one or more nucleic acids are selected from the group consisting of SEQ ID NOS 1-11

### Claim 11 (depends on 8)

The method of claim 8, wherein the bone loss is associated with ankylosing spondylitis, renal osteodystrophy, osteoporosis, glucocorticoid-induced osteoporosis, Paget's disease, abnormally increased bone turnover, periodontitis, bone fractures, rheumatoid arthritis, osteoarthritis, periprosthetic osteolysis, osteogenesis imperfecta, metastatic bone disease, hypercalcemia of malignancy, multiple myeloma, bone loss associated with microgravity, Langerhan's Cell Histiocytosis (LHC), or bone loss associated with renal tubular disorders, or bone loss associated with bed-ridden conditions.

### Claim 12 (depends on 8)

The method of claim 8, wherein the bone loss is associated with osteoporosis.