Ncam-vase and neurodegeneration
OwnerJane Louise Saffell, Michael Jonathan Delves +1inventors
InventorsJane Louise Saffell, Michael Jonathan Delves, Alexandra Antoinette Anderson
Life of this patent
Estimating the term…
Abstract
Inhibitors of NCAM-VASE, compositions comprising said inhibitors, and methods of using said inhibitors for stimulation of neuroplasticity and/or neuroregeneration in the central nervous system, and for increasing neuronal cell response to agents that stimulate neuroplasticity and/or neuroregeneration in the central nervous system, are provided. The inhibitor or composition may be used, for example, for treating brain or spinal cord injury; schizophrenia, motor neurone disease; a neurodegenerative disorder such as Alzheimer's disease, multiple sclerosis or Parkinson's disease; ischaemia caused by stroke; or for improving learning and/or memory.
Claims27
(canceled)
(canceled)
The method of claim 12 wherein the inhibitor is an antisense RNA molecule or an interfering RNA that is capable of causing a reduction of NCAM-VASE mRNA transcription.
The method of claim 12 wherein the inhibitor is a soluble polypeptide comprising the Ig4 domain of NCAM-VASE.
The method of claim 12 wherein the inhibitor is an antibody or antibody fragment or derivative able to bind selectively to NCAM-VASE.
The method of claim 12, wherein the inhibitor is administered in combination with a second agent which promotes neuroplasticity and/or neuroregeneration.
The method of claim 12, wherein the method is for treating brain or spinal cord injury.
The method of claim 12, wherein the method is for treating schizophrenia, motor neurone disease, for treating a neurodegenerative disorder including Alzheimer's disease, multiple sclerosis or Parkinson's disease;
- for treating ischaemia caused by stroke;
- or for improving learning and/or memory.
(canceled)
A method of stimulating in vitro or in vivo neuroplasticity and/or neuroregeneration comprising providing an inhibitor of NCAM-VASE to neuronal cells and/or tissues.
A method of enhancing neuroplasticity and/or neuroregeneration in a human subject in need thereof comprising providing a therapeutically effective amount of an inhibitor of NCAM-VASE to said subject.
(canceled)
A compound which inhibits NCAM-VASE but which does not inhibit other isoforms of NCAM, said inhibitor selected from the group consisting of, an anti-sense nucleic acid or an interfering nucleic acid capable to selectively reducing the expression of an mRNA having the nucleotide sequence:
- gcttcgtggactcgaccagagaagcaagag (SEQ ID NO:
- 1);
- an antibody or derivative thereof able to bind to NCAM-VASE;
- and a soluble protein comprising the Ig4 domain of NCAM-VASE.
(canceled)
(canceled)
(canceled)
Dependencies are inferred from the claim text.