Micro-RNA Associated With Rheumatoid Arthritis
AssigneeNational University Corporation Kobe University
InventorsSeiji Kawano, Yuji Nakamachi
Life of this patent
Estimating the term…
Abstract
An object of the present invention is to provide a novel marker for rheumatoid arthritis (RA), and more specifically, to provide a marker whose expression may be specifically increased or decreased in RA. Another object of the present invention is to confirm whether or not miRNA serving as the marker is involved as the etiology of RA, and to provide an inspection method for RA and a therapeutic agent for RA each using the miRNA involved. The marker includes miRNA (for example, miR124a) whose expression is specifically increased or decreased in RA synovial cells based on a small RNA expression profile in the RA synovial cells. In addition, the therapeutic agent for RA includes miRNA (for example, miR124a) as an active ingredient.
Claims7
1-10. (canceled)
A therapeutic method for rheumatoid arthritis comprising administering to a subject in need thereof a therapeutic agent comprising an oligonucleotide as an active ingredient formed of a base sequence selected from the following:
- (1) UUAAGGCACGCGGUGAAUGCCA;
- (SEQ ID NO:
- 1)
- and
- (2) a base sequence having substitutions, deletions, additions, or insertions of one or two nucleotides in an oligonucleotide formed of a base sequence according to the above-mentioned item (1).
Dependencies are inferred from the claim text.