Porcine Adenovirus 3-Based PRRSV Vaccines

A vaccine for the protection of pigs against diseases caused by PRRSV, said vaccine comprising a recombinant PADV3 virus vector comprising a heterologous nucleic acid that encodes a fusion of PRRS virus ORF6 and ORF5, inserted into a non-essential site of the PADV3 wherein said ORF5 is a modified ORF5 that contains a spacer sequence to separate the neutralizing and non-neutralizing epitopes encoded by ORF5 wherein the sequence of the nucleic acid encoding the ORF6ORF5m is the sequence of SEQ ID NO:1 or SEQ ID NO:2, wherein the spacer sequence encodes a Pan DR T-helper cell epitope (PADRES) as encoded by a sequence GCTAAATTTGTCGCAGCCTGGACTCTTAAGGCAGCGGCT (SEQ ID NO:22) or the sequence of GCTAAATTTGTCGCAGCCTGGACTCTTAAGGCAGCGGCT (SEQ ID NO:22) in SEQ ID NO:1 or SEQ ID NO:2 is replaced by any other nucleic acid sequence that encodes a peptide of between 10 to 15 amino acids in length.

An expression construct comprising a CMV promoter operatively linked to a nucleic acid that encodes an ORF6 fused to a modified ORF5 wherein the modified ORF5 has been modified to spatially separate the neutralizing and non-neutralizing epitopes, wherein said expression construct further comprises a nucleic acid that encodes PRRS ORF7 operatively linked to a major late promoter and said ORF5m encoding sequence and said ORF7 sequence comprise a polyA flanking sequence.