Use of the Ornithine Transcarbamylase (OTC), as a Marker for Diagnosing Brain Damages

2:

• The method of claim 1, wherein said brain alteration is diagnosed at an infra-clinic level.

3:

• The method of claim 1, for in vitro diagnosing a neurodegenerative disease.

4:

• The method of claim 1, for in vitro diagnosing an Alzheimer's disease.

5:

• The method of claim 1, for in vitro diagnosing a non-Alzeimer's disease dementia.

6:

• The method of claim 1 or, wherein said individual suffers from a mild cognitive impairment.

7:

• The method according to claim 1, wherein the detection of ornithine transcarbamylase (OTC) in said sample of cerebrospinal fluid is performed by detecting the OTC activity.

8:

• The method of claim 7, wherein the OTC activity is detected and quantified by measuring the production of citrulline after addition of carbamyl phosphate and ornithine to said sample.

9:

• The method of claim 7, wherein the OTC activity is assayed by calorimetrically measuring the amount of citrulline produced.

The method according to claim 1, wherein the OTC activity is measured through an assay based on the reverse reaction of ornithine transcarbamylase.

11:

• The method according to claim 1, wherein the detection of ornithine transcarbamylase (OTC) in said sample of cerebrospinal fluid is performed by immunoassay with a monoclonal or polyclonal antibody directed against OTC.

12:

• The method according to claim 1, wherein the presence of ornithine transcarbamylase in the cerebrospinal fluid is indicative of a brain disease.

13:

• A method for determining the genetic predisposition of an individual to a brain disease comprising detecting ornithine transcarbamylase (OTC) in a biological sample.

14:

• A method for in vitro predicting an increased risk, for an individual, of developing a brain disease, comprising a step of genotyping the region controlling the expression of the ornithine transcarbamylase (OTC) gene in a biological sample from said individual.

15:

• A method for in vitro diagnosing a brain disease in an individual, comprising a step of genotyping the region controlling the expression of the ornithine transcarbamylase (OTC) gene in a biological sample from said individual.

16:

• The method of claim 13, wherein said brain disease is a neurodegenerative disease.

17:

• The method according to claim 16, wherein said neurodegenerative disease is Alzheimer's disease.

18:

• The method of claim 13, wherein the −389 A/G and −241 G/A polymorphisms are analyzed.

19:

• The method of claim 18, comprising a step of amplification of one or two fragments of the region controlling the expression of the ornithine transcarbamylase (OTC) gene comprising the −389 and −241 nucleotides.

20:

• The method of claim 19, wherein a polymerase chain reaction is performed, with the primers CTCCTGAGGTGGCCATAGTTG (SEQ ID No:
• 1) and CCAACATGGTGAATCCCCGTC (SEQ ID No:
• 2).

21:

• The method according to claim 19, wherein the genotyping of the −389 A/G and −241 G/A polymorphisms is performed by analysis of enzymatic restriction patterns of the amplification product(s).

22:

• The method according to claim 21, wherein the genotyping of the −389 A/G polymorphism comprises a restriction of an amplification product by AlwNI and the genotyping of the −241 G/A polymorphism comprises a restriction of an amplification product by HinI.

23:

• The method of claim 18, wherein the G−389-G−241, haplotype is indicative of a decreased risk of developing Alzheimer's disease, and the A−389-A−241, haplotype is indicative of an increased risk of developing Alzheimer's disease.

24:

• A method for diagnosing a brain alteration in a deceased individual, comprising a step of labelling a brain biopsy from said individual, with an anti-OTC antibody.

25:

• The method of claim 11, wherein said antibody is a monoclonal or polyclonal antibody obtained against a polypeptide specific of the human OTC.

26:

• The method of claim 25, wherein said antibody is a polyclonal antibody obtained against the polypeptide MKTAKVAASDWTFLHCLPRK (SEQ ID No:
• 17).

27:

• The method according to claim 11, wherein the presence of ornithine transcarbamylase in cerebrovascular endothelial cells is indicative of a brain alteration.

28:

• The method according to claim 11, wherein the presence of ornithine transcarbamylase in cerebrovascular endothelial cells is indicative of Alzheimer's disease.

29:

• A method for the in vitro diagnosis of a brain disease comprising incubating an antibody directed against human ornithine transcarbamylase with a biological sample.

30:

• The use of claim 29, wherein said brain disease is a mild cognitive impairment, Alzheimer's disease, or a non-Alzheimer's disease dementia.

31:

• A screening method for identifying compounds able to prevent, alleviate or treat Alzheimer's disease and/or other brain diseases, comprising a step of identifying compounds which modulate the expression and/or the activity of the ornithine transcarbamylase in cells.

32:

• The method according to claim 31, wherein the ability of compounds to modulate the expression and/or the activity of the ornithine transcarbamylase is assayed in cultured vascular endothelial cells which express the OTC gene.

33:

• A kit for performing a method according to claim 1, comprising at least a solution of ornithine and a solution of carbamyl phosphate.

34:

• The kit of claim 33, which comprises also at least a solution of triethanolamine and/or a solution of phosphoric acid and sulphuric acid, and/or a solution of butanedione.

35:

• A kit for performing a method according to claim 1, comprising at least an anti-OTC antibody.

36:

• The kit of claim 35, wherein said anti-OTC antibody is a monoclonal or a polyclonal antibody directed against the polypeptide MKTAKVAASDWTFLHCLPRK (SEQ ID No:
• 17).

37:

• A kit for performing a method according to claim 11, comprising at least a set of primers for amplifying the region controlling the expression of the ornithine transcarbamylase (OTC) gene comprising the −389 and −241 nucleotides.

38:

• The kit according to claim 37, further comprising AlwNI and HinI restriction enzymes.

39:

• A transgenic non-human mammal, characterized in that it carries an expression cassette for expressing OTC in a conditional and/or tissue-specific manner.

40:

• The transgenic animal according to claim 39, in which the expression of the OTC transgene is dependent on the activity of an inducible transcriptional activator.

41:

• The transgenic animal according to claim 40, in which the OTC transgene is under the control of a tetracycline-responsive promoter element (TRE).

42:

• The transgenic animal according to claim 40, in which said inducible transcriptional activator is a tetracycline-controlled transactivator protein (tTA), wherein said tTA is expressed under the control of a tissue-specific promoter.

43:

• The transgenic animal according to claim 42, wherein said tTA is expressed under the control of a vascular endothelial cadherin promoter.