Immunostimulatory oligonucleotides and uses thereof
AssigneeImmunotech
InventorRicardo Agustin Lopez
Life of this patent
Estimating the term…
Abstract
Oligonucleotides containing the non-palindromic sequence motif: X1X2X3X4X5X6X7X8, wherein X1 is C, T, G or A (preferably T or C); wherein X2 is C, T, G or A; wherein X7 is C, T, G or A (preferably G); at least three, and preferably all, of X3, X4, X5, X6 and X8 are T; and with the proviso that, in the motif, a C does not precede a G (in other terms, the nucleic acid motif does not consist of a CpG oligonucleotide), that modulate the immune response of animals of the order Primate, including humans, are disclosed. This immune modulation is characterized by stimulation of proliferation, differentiation, cytokine production and antibody production on B-cells and cell differentiation on plasmacytoid dendritic cells.
Claims37
A method for inducing B-cell activation in a subject in need of such activation comprising administering to the subject an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence selected from the group consisting of TCTTCTTTTTGTCTTTTTGTCTTT (SEQ ID No 4), TCATTATTTTGTTATTTTGTCATT (SEQ ID No:15), TCATCCTTTTGTCCTTTTGTCATT (SEQ ID No:17);
- TTTTTTTTTT TTTTTTTTTT TTTT (SEQ ID NO:
- 19) and TCATCAATTTGTCAATTTGTCATT (SEQ ID No:30).
A method for treating, preventing or ameliorating a tumoral disease in a subject comprising the steps of:
- (a) contacting white blood cells obtained from the subject with an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence selected from the group consisting of TCTTCTTTTTGTCTTTTTGTCTTT (SEQ ID No 4), TCATTATTTTGTTATTTTGTCATT (SEQ ID No:15), TCATCCTTTTGTCCTTTTGTCATT (SEQ ID No:17);
- TTTTTTTTTT TTTTTTTTTT TTTT (SEQ ID NO:19) and TCATCAATTTGTCAATTTGTCATT (SEQ ID No:30), ex vivo, thereby producing activated B lymphocytes;
- and
- (b) readministering the activated white blood cells obtained in step a) to the subject.
A method of vaccination of a subject where the immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence selected from the group consisting of TCTTCTTTTTGTCTTTTTGTCTTT (SEQ ID No 4), TCATTATTTTGTTATTTTGTCATT (SEQ ID No:15), TCATCCTTTTGTCCTTTTGTCATT (SEQ ID No:17);
- TTTTTTTTTT TTTTTTTTTT TTTT (SEQ ID NO:19) and TCATCAATTTGTCAATTTGTCATT (SEQ ID No:30), and an antigen are administered to the subject by intramuscular injection at the same site.
A method of vaccination of a subject where the oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence selected from the group consisting of TCTTCTTTTTGTCTTTTTGTCTTT (SEQ ID No 4), TCATTATTTTGTTATTTTGTCATT (SEQ ID No:15), TCATCCTTTTGTCCTTTTGTCATT (SEQ ID No:17);
- TTTTTTTTTT TTTTTTTTTT TTTT (SEQ ID NO:19) and TCATCAATTTGTCAATTTGTCATT (SEQ ID No:30), and the antigen are administered by the oral, intranasal, anal, vaginal, transdermic or mucosal route.
A method for inducing plasmacytoid dendritic cell activation in a subject in need of such activation comprising administering to the subject an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence selected from the group consisting of TCTTCTTTTTGTCTTTTTGTCTTT (SEQ ID No 4), TCATTATTTTGTTATTTTGTCATT (SEQ ID No:15), TCATCCTTTTGTCCTTTTGTCATT (SEQ ID No:17);
- TTTTTTTTTT TTTTTTTTTT TTTT (SEQ ID NO:19) and TCATCAATTTGTCAATTTGTCATT (SEQ ID No:30).
Dependencies are inferred from the claim text.