Immunostimulatory oligonucleotide that induces interferon alpha
AssigneesEmori & Co. Ltd., University of Fukui
InventorsHarukazu Kitagawa, Sumiko Iho, Takasumi Matsuki, Saburo Yamamoto
Life of this patent
Estimating the term…
Abstract
An immunostimulatory oligonucleotide that is represented by the general formula 5′-Gm-GACGATCGTC-Gn-3′ or 5′-Gm-CACGATCGTG-Gn-3′ (in the formula, m and n are each independently an integer from 1 to 9 and m+n=10) and that comprises any of the following base sequences: GGACGATCGTCGGGGGGGGG, (SEQ ID NO: 1) GGGACGATCGTCGGGGGGGG, (SEQ ID NO: 2) GGGGACGATCGTCGGGGGGG, (SEQ ID NO: 3) GGGGGGGACGATCGTCGGGG, (SEQ ID NO: 4) GGGGGGGGACGATCGTCGGG, (SEQ ID NO: 5) GGGGGGGGGACGATCGTCGG, (SEQ ID NO: 6) GGGGGGGGGGACGATCGTCG, (SEQ ID NO: 7) and GGGGGGGGGCACGATCGTGG. (SEQ ID NO: 8)
Claims7
An immunostimulatory oligonucleotide that comprises the following base sequence:
- GGGGGGGGGGACGATCGTCG.
- (SEQ ID NO:
- 7)
2-3. (canceled)
A pharmaceutical formulation comprising as an active ingredient an immunostimulatory oligonucleotide comprising the base sequence GGGGGGGGGGACGATCGTCG (SEQ ID NO:
- 7).
(canceled)
A pharmaceutical formulation comprising as an active ingredient an immunostimulatory oligonucleotide comprising the base sequence GGGGGGGGGGACGATCGTCG (SEQ ID NO:
- 7), and further comprising an immunomodulating factor.
(canceled)
Dependencies are inferred from the claim text.