Small interfering RNA libraries and methods of synthesis and use

A method for preparing a siRNA library, the method comprising:

• (1) generating a population of oligoDNAs, each of which comprises a random or semirandom sequence, bounded by restriction sites optionally followed by a priming sequence,
• (2) extending the complementary strand to make double-stranded oligoDNAs,
• (3) cloning the oligoDNAs into an RNA expression vector system having vectors comprising a first RNA promoter and an second RNA promoter, the first and second promoters oriented inward to direct RNA transcription of respective sense and antisense complementary sequences positioned between the first and second RNA promoters, wherein the oligoDNAs sequences are cloned into said vectors between said first and said second promoters;
• and
• (4) pooling the vectors containing the inserts from step (3) to form a form an siRNA-encoding library.

A method for preparing a siRNA library, the method comprising:

• (1) generating a population of oligoDNAs, each of which comprises (5′ to 3′) a preselected restriction site, a random or semirandom sequence, a first sequence contributing to a priming loop, a spacer sequence, and a second sequence contributing to a priming loop, whereby the first sequence contributing to a priming loop the second sequence contributing to a priming loop anneal to form a loop.
• (2) exposing the population of oligoDNAs to a DNA polymerase under suitable conditions to extend the complementary strand from the end of the second sequence contributing to a priming loop through the template strand preselected restriction site;
• (3) denaturing the double stranded extended oligoDNAs for form single stranded extended oligoDNAs;
• (4) synthesizing the complementary strand to the single stranded extended oligoDNAs for form siRNA-encoding DNAs under conditions that minimizes self-annealing of the template;
• (5) pooling the siRNA-encoding DNAs to form an siRNA-encoding library.

A nucleic acid molecule having a sequence comprising at least ten consecutive nucleic acids selected from the following or their complementary sequences:

• AAGGCCTTCTTCAAGAGAAGT,
• (SEQ ID NO:45)
• AAGATCACAGACACTTTGATC,
• (SEQ ID NO:46)
• AAGGCCUUCUUCAAGAGAAGU,
• (SEQ ID NO:49)
• and
• AAGAUCACAGACACUUUGAUC
• (SEQ ID NO:50)

A method of generating DNA hairpins comprising

• (1) generating a population of oligoDNAs, each of which is flanked by a 3′ restriction site and a 5′ restriction site, wherein the 3′ restriction site is different than the 5′ restriction site,
• (2) cloning the oligoDNAs into plasmids having two recombinase sites oriented toward each other so as to orient the oligoDNAs flanked by the 3′ restriction site and the 5′ restriction site between the dual recombinase sites;
• (3) replicating the plasmids within a population of host cells that produce the appropriate recombinase enzyme for the particular recombinase recognition sites present in the plasmids;
• (4) exposing the plasmids to the recombinase enzyme within the host cells;
• (5) isolating plasmid DNA from the population host cells and digesting the isolated plasmids with a restriction enzymes specific for either the 3′ restriction site or the 5′ restriction site;
• (6) autoligating the digested fragment containing a dual cassette wherein said dual cassettes comprise a sense sequence and a complementary sequence corresponding to said oligoDNAs separated by a spacer sequence which comprises either said 3′ or said 5′ restriction site.