Detection of human herpes virus 6 (HHV6)

A method for detecting HHV6 in a sample suspected of containing HHV6. the method comprising the steps of:

• (a) optionally amplifying viral DNA present in the sample by polymerase chain reaction techniques using outer primers complementary to the viral DNA;
• (b) adding to the sample, or to the sample having undergone optional amplification step (a), a pair of inner oligonucleotide primers complementary to and specific for HHV6 DNA, wherein the inner primers comprise the sequences 5′AAGCTTGCACAATGCCAAAAAACAG and 5′CTCGAGTATGCCGAGACCCCTAATC, or functionally equivalent sequences;
• (c) carrying out polymerase chain reaction techniques on the sample so as to amplify the HHV6 DNA spanned by the inner primers present in the sample;
• and
• (d) detecting the amplified HHV6 DNA.

A method for detecting HHV6 is a sample suspected of containing HHV6, the method comprising the steps of:

• (a) optionally amplifying viral DNA present in the sample by polymerase chain reaction techniques by
• (i) adding outer primers complementary to the viral DNA in the sample,
• (ii) providing buffers, reagents, nucleotides and a thermostable DNA polymerase to the sample to form a reaction mixture,
• (iii) heating the reaction mixture to a temperature such that double stranded viral DNA present denatures to form single stranded DNA molecules,
• (iv) cooling the reaction mixture to a temperature such that the outer primers anneal to their respective complementary sequences on the denatured single stranded DNA molecules,
• (v) heating the reaction mixture to a temperature such that the DNA polymerase extends the primers to form new double stranded DNA molecules spanning the region of DNA defined by the outer primers, and
• (vi) repeating steps (iii), (iv) and (v) such that the number of copies of the region of DNA encoding the double stranded viral DNA is amplified;
• (b) adding to the optionally amplified sample a pair of inner oligonucleotide primers complementary to and specific for HHV6 DNA, wherein the inner primers comprise the sequences 5′AAGCTTGCACAATGCCAAAAAACAG and 5′CTCGAGTATGCCGAGACCCCTAATC, or functionally equivalent sequences;
• (c) heating the reaction mixture to a temperature such that the optionally amplified double stranded viral DNA denatures to form single stranded DNA molecules;
• (d) cooling the reaction mixture to a temperature such that the inner primers anneal to their respective complementary sequences on the denatured DNA;
• (e) heating the reaction mixture to a temperature such that the DNA polymerase extends the primers to form new double stranded DNA molecules spanning the region of DNA defined by the inner primers;
• (f) repeating steps (c), (d) and (e) such that the number of copies of the region of DNA is amplified;
• and
• (g) detecting the amplified DNA.