Loading patent…
AssigneeBiovitrum AB
InventorsGUNNAR NORSTEDT, TIM WOOD, DANIEL SLIVA, BERTIL ENBERG, PETER LOBIE, LARS-ARNE HALDOSEN
Estimating the term…
A method of enhancing the transcription of a gene in a DNA construct incorporated into the genome of a eucaryotic host cell, wherein the DNA construct comprises a structural gene for a desired protein or polypeptide in a gene promoter upstream of the structural gene, comprises providing at least one enhancer element comprising the nucleotide sequence TTC TGA GAA upstream of the promoter, and exposing the DNA construct to lactogenic stimuli. An expression vector, a host cell and a transgenic mammal containing the vector are of interest.
A method of enhancing the transcription of a gene in a DNA construct incorporated into the genome of a eucaryotic host cell said DNA construct comprising a structural gene for a desired protein or polypeptide and a gene promoter upstream of the structural gene, characterized by providing upstream of said promoter at least one enhancer element comprising the nucleotide sequence TTC TGA GAA, and exposing the DNA construct to lactogenic stimuli.
Use of an enhancer element comprising the nucleotide sequence TTC TGA GAA in an expression vector to be used in a non-human mammal for the production of recombinant proteins or polypeptides in milk.
An enhancer element which when used in a DNA construct for transfection of a eucaryotic host cell is responsive to hormonal stimuli, characterized in that said enhancer element comprises the nucleotide sequence TTC TGA GAA, with the proviso that said nucleotide sequence is not the DNA sequence of the SPI-growth hormone responsive element (SPI-GHRE).
An expression vector comprising a structural gene encoding a desired protein or polypeptide and a promoter, characterized in that the vector further comprises at least one enhancer element including the nucleotide sequence TTC TGA GAA, with the exception of the SPI-growth hormone responsive element (SPI-GHRE).
An expression vector comprising a structural gene encoding a desired protein and a mammary tissue specific promoter, characterized in that it further comprises at least one enhancer element including the nucleotide sequence TTC TGA GAA.
A transgenic non-human mammal having incorporated into its genome a DNA construct comprising a structural gene encoding a desired protein or polypeptide linked to a control sequence for expression in milk-secreting epithelal cells of the mammary gland so that the protein or polypeptide is secreted into the milk, characterized in that said DNA construct further comprises at least one enhancer element which includes the nucleotide sequence TTC TGA GAA and is responsive to signals generated from prolactine receptors.
Dependencies are inferred from the claim text.
Drawings are temporarily unavailable. Open the PDF at USPTO
From the US filing history. Foreign family members aren’t listed.
Backward citations are indexed for grants only.
For animal cells: for producing genetically modified animals, e.g. transgenic
Vectors or expression systems specially adapted for eukaryotic hosts: for animal cells
Genetically modified animals: animals comprising random inserted nucleic acids
Animals characterised by species: mammal
Term end not estimated
USPTO file history isn’t available for this patent, so only indexed dates are shown.
The present invention relates to DNA plasmids to be used for the production of recombinant proteins. More specifically, the present invention concerns the addition of specific DNA elements to expression plasmids that serve a function as enhancing elements. The outcome is to improve the yields of recombinant protein production.
There are a number of different strategies for the large-scale production of recombinant proteins to be used in, for example, the pharmaceutical industry. In certain cases it is desirable that the recombinant protein is made in eucaryotic hosts. These hosts may be cultivated cells or animals made transgenic with respect to the gene of interest. In the latter situation, transgenic expression in milk is a valuable technique since transgenes, active in the mammary gland, have been described and milk is a readily available body fluid.
The present invention relates to, in an unrestricted way, an improvement in expression vectors used to produce recombinant proteins in milk. These improved expression vectors will increase the yield of valuable recombinant proteins which will be of value for the facilitation of subsequent handling and purification steps.
Identification of a Core GH Regulated Sequence.
The 50 bp SPI-GHRE; (GATCTACGCTTCTACTAATCCATGTTCTGAGAAATCATC CAGTCTGCCCATG) was used to identify a core GH regulated sequence using gel electrophoresis mobility shift assay (GEMSA). Nuclear extracts were prepared and incubated with a 32P labelled 50 bp SPI-GHRE. Subsequently the extracts were analysed on polyacrylamide gels. The results showed that nuclear proteins, dependent on GH, bound to this DNA sequence. By competition with shorter oligonucleotides derived from SPI-GHRE a core GH sequence was identified. Based on certain sequence homologies to interferon response-elements we called this sequence SPI-GAS and also demonstrated that SPI-GAS functions as a GH regulated DNA element when put into a reporter vector. The core SPI-GAS has the following sequence; TTCTGAGAA.
Prolactin and Growth Hormone both Activate SPI-TK-Reporter Gene.