Implication of a known gene named cp2/lsf-lbp-1 in alzheimer's desease

#The invention relates to the implication of a known gene named CP2/LSF-LBP-1 in Alzheimer's disease, namely in sporadic forms of Alzheimer's disease.

#Alzheimer's disease is a neurodegenerative process characterised by two main cerebral lesions: amyloid plaques and neurofibrillary degeneration. Numerous data suggested that the first step of the development of the disease would be the formation of the senile plaques, leading to neurodegeneration and finally to dementia. To better understand the etiology of the pathology, a systematic search for genes responsible of the monogenic familial forms of Alzheimer's disease have been undertaken. At present, three genes have been discovered, bearing pathogenic mutations: the APP gene on chromosome 21 (Goate et al, 1991), the PS1 and PS2 genes on chromosome 14 and 1 respectively (Sherrington et al, 1995; Levy-Lahad et al, 1995).

#Even if the discovery of these mutations were essential for the understanding of the Alzheimer's disease process, they explain only less than 2% of all Alzheimer's disease cases (Cruts et al, 1998). Indeed, most of the forms are sporadic, without obvious mendelian inheritance. To date, only one gene has been recognized as a major risk factor for the sporadic form, the APOE gene on chromosome 19, the α4 allele of this gene strongly increasing the risk of developing the disease (Saunders et al, 1993). Furthermore, expression of this gene may be an important determinant for the disease, mutations in the APOE promoter modulating the disease risk (Bullido et al, 1998; Lambert et al, 1998).

#The following examples and figures are intended to illustrate the invention.

#In the annexed figures,

#FIG. 1 represents a comparison between sequences of the APOE promoter region encompassing the −216 GT polymorphism and an HIV regulatory element, containing a CP2/LSF-LBP-1 binding domains (Parado et al, 1995); similar consensus sequences were indicated in bold.

#Polymorphisms of CP2/LSF-LBP-1 Gene

#We sequenced the entire gene of CP2/LSF/LBP-1 using the oligonucleotides as described in Tables 1 and 2. 1 TABLE 1 Listing of the oligonucleotides for RT-PCR product sequencing. Fragment Sequencing of CP2/LSF/LBP-1 ARNm by RT-PCR length RT-PCR 1 (SEQ ID no 6) Forward primer GGCGAGTCTAGGTTTTACGC 416 bp (SEQ ID no 7) Reverse primer CTCTCAGGAACGGTGAGGACC RT-PCR 2 (SEQ ID no 8) Forward primer CAAGCCACCACTACGAACTC 515 bp (SEQ ID no 9) Reverse primer TTATCAGGAGGCAAACTCGA RT-PCR 3 (SEQ ID no 10) Forward primer AGCATGAGTGATGTCCTTGC 482 bp (SEQ ID no 11) Reverse primer CCGCCATGTTTCCTCATAGT RT-PCR 4 (SEQ ID no 12) Forward primer ACCCTGCAAAGAGGACATCT 499 bp (SEQ ID no 13) Reverse primer TTCAATAAATCTGCCCCTGA RT-PCR 5 (SEQ ID no 14) Forward primer CAACAACCACACCTCAGGAA 409 bp (SEQ ID no 15) Reverse primer CCCTGCTTGTAAATCTGGCT RT-PCR 6 (SEQ ID no 16) Forward primer AATTGCTCAGCTTTTCAGCA 376 bp (SEQ ID no 17) Reverse primer CCCTCTGTGTGTACCACAA

#All the RT-PCR reactions for sequencing were performed according to the supplier recommendation (Titan™ one tube system, ROCHE) at a Tm of 52° C.