Amplification

A mixture according to any preceding claim in which one or more of the listed sequences of the primers have locus specific portions and/or universal portions according to the following forms:

• 13 Pair 1 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 1 ccagatgtttctcaagtggtcctg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 2 aaagtggtttctcaagtggtccca (locus specific portion) Pair 2 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 4 cctctgctttaaccacaccagca (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 5 cctctgctttaaccacaccagcc (locus specific portion) Pair 3 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 7 accaaccccacaaagcagg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 8 accaaccccacaaagcagc (locus specific portion) Pair 4 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 10 ctctttccacctgaaagcaaggg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 11 ctctttccacctgaaagcaaggt (locus specific portion) Pair 5 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 13 cgcagcccttgccatctg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 14 cgcagcccttgccatctc (locus specific portion) Pair 6 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 16 cttagatgtcacctcttccatgcac (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 17 cttagatgtcacctcttceatgcag (locus specific portion) Pair 7 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 19 gcgggaggaaggaagggagg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 20 gcgggaggaaggaagggagc (locus specific portion) Pair 8 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 22 gatgcetcttgcattgtgaacg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 23 gatgceteugcattgtgaace (locus specific portion) Pair 9 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 25 cattgtgtttcaaacgcgtgcc (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 26 cattgtgtttcaaacgcgtgct (locus specific portion) Pair 10 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 28 tgccactctgacactgatgcttg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 29 tgccactctgacactgatgcttc (locus specific portion) Pair 11 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 31 ctgccttggctcccagcc (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 32 ctgccttggctcccagct (locus specific portion) Pair 12 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 34 cacaaagctgatctgagcacctauac (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 35 cacaaagctgatctgagcacctattag (locus specific portion) Pair 13 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 37 gctgtgggctctatgtatcatccaac (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 38 gctgtgggctctatgtatcatccaag (locus specific portion) Pair 14 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 40 gcccaatggctaatttccttacatg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 41 gcccaatggctaatttccttacatc (locus specific portion) Pair 15 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 43 gggaaactgctgggtctgt (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 44 gggaaactgctgggtctgc (locus specific portion) Pair 16 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 46 ctgtgcatccactgcgcc (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 47 ctgtgcatccactgcgca (locus specific portion) Pair 17 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 49 cctggagcatgagctgaccac (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 50 cctggagcatgagctgaccaa (locus specific portion) Pair 18 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 52 ccatgcctcacctcctgcatt (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 53 ccatgcctcacctcctgcatc (locus specific portion) Pair 19 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 55 gcatgccattgccaaaucc (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 56 gcatgccattgccaaattct (locus specific portion) Pair 20 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 58 gccaaccagacctcccagg (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 59 gccaaccagacctcccagc (locus specific portion) Pair 21 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 61 gggagacaggcccatgca (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 62 gggagacaggcccatgct (locus specific portion) Pair 22 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 64 cagaaaaggcaggaacctggaca (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 65 cagaaaaggcaggaacctggact (locus specific portion) Pair 23 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 67 gagccaagaatcgcagggaa (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 68 gagccaagaatcgcagggat (locus specific portion) Pair 24 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 70 tgtgcatgttccctggtgttca (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 71 tgtgcatgttccctggtgttct (locus specific portion) Pair 25 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 73 ggcatacccatgtgactaaatgttga (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 74 ggcatacccatgtgactaaatgttgt (locus specific portion) Pair 26 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 76 gcaaggcccaaagcaaagaa (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 77 gcaaggcccaaagcaaagat (locus specific portion) Pair 27 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 79 aggacagtggcttctgtactgcta (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 80 aggacagtggcttctgtactgctt (locus specific portion) Pair 28 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 82 ctggaagggctttgtttgccaa (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 83 ctggaagggctttgtttgccat (locus specific portion) Pair 29 Primer 1 cgacgtggtggatgtgctag (universal portion) {close oversize parenthesis} SEQ ID NO 85 gggggtactggggagaccaa (locus specific portion) Primer 2 tgacgtggctgacctgagac (universal portion) {close oversize parenthesis} SEQ ID NO 86 gggggtactggggagaccat (locus specific portion)
• or sequences at least 75% homologous thereto in respect of the universal portion.

A method of investigating single nucleotide polymorphisms in a sample of DNA, the method comprising contacting the DNA containing sample with at least one set of first primers, amplifying the DNA using those primers to give an amplified product, contacting at least a portion of the amplified product with at least one second set of primers, amplifying the DNA using those second set of primers to give a further amplified product and examining one or more characteristics of the further amplified product, in which the first primers include one or more pairs of primers pairs, at least one of those primer pairs being a primer pair having or including the following sequences:

• 14 Pair 1 Primer 1 cgacgtggtggatgtgctagccagatgtttctcaagtggtcctg SEQ ID NO 1 Primer 2 tgacgtggctgacctgagacaaagtggtttctcaagtggtccca SEQ ID NO 2 Pair 2 Primer 1 cgacgtggtggatgtgctagcctctgctttaaccacaccagca SEQ ID NO 4 Primer 2 tgacgtggctgacctgagaccctctgctttaaccacaccagcc SEQ ID NO 5 Pair 3 Primer 1 cgacgtggtggatgtgctagaccaaccccacaaagcagg SEQ ID NO 7 Primer 2 tgacgtggctgacctgagacaccaaccccacaaagcagc SEQ ID NO 8 Pair 4 Primer 1 cgacgtggtggatgtgctagctctttccacctgaaagcaaggg SEQ ID NO 10 Primer 2 tgacgtggctgacctgagacctctttccacctgaaagcaaggt SEQ ID NO 11 Pair 5 Primer 1 cgacgtggtggatgtgctagcgcagcccttgccatctg SEQ ID NO 13 Primer 2 tgacgtggctgacctgagaccgcagcccttgccatctc SEQ ID NO 14 Pair 6 Primer 1 cgacgtggtggatgtgctagcttagatgtcacctcttccatgcac SEQ ID NO 16 Primer 2 tgacgtggctgacctgagaccttagatgtcacctcttccatgcag SEQ ID NO 17 Pair 7 Primer 1 cgacgtggtggatgtgctaggcgggaggaaggaagggagg SEQ ID NO 19 Primer 2 tgacgtggctgacctgagacgcgggaggaaggaagggagc SEQ ID NO 20 Pair 8 Primer 1 cgacgtggtggatgtgctaggatgcctcttgcattgtgaacg SEQ ID NO 22 Primer 2 tgacgtggctgacctgagacgatgcctcttgcattgtgaacc SEQ ID NO 23 Pair 9 Primer 1 cgacgtggtggatgtgctagcattgtgtttcaaacgcgtgcc SEQ ID NO 25 Primer 2 tgacgtggctgacctgagaccattgtgtttcaaacgcgtgct SEQ ID NO 26 Pair 10 Primer 1 cgacgtggtggatgtgctagtgccactctgacactgatgcttg SEQ ID NO 28 Primer 2 tgacgtggctgacctgagactgccactctgacactgatgcttc SEQ ID NO 29 Pair 11 Primer 1 cgacgtggtggatgtgctagctgccttggctcccagcc SEQ ID NO 31 Primer 2 tgacgtggctgacctgagacctgccttggctcccagct SEQ ID NO 32 Pair 12 Primer 1 cgacgtggtggatgtgctagcacaaagctgatctgagcacctattac SEQ ID NO 34 Primer 2 tgacgtggctgacctgagaccacaaagctgatctgagcacctattag SEQ ID NO 35 Pair 13 Primer 1 cgacgtggtggatgtgctaggctgtgggctctatgtatcatccaac SEQ ID NO 37 Primer 2 tgacgtggctgacctgagacgctgtgggctctatgtatcatccaag SEQ ID NO 38 Pair 14 Primer 1 cgacgtggtggatgtgctaggcccaatggctaatttccttacatg SEQ ID NO 40 Primer 2 tgacgtggctgacctgagacgcccaatggctaatttccttacatc SEQ ID NO 41 Pair 15 Primer 1 cgacgtggtggatgtgctaggggaaactgctgggtctgt SEQ ID NO 43 Primer 2 tgacgtggctgacctgagacgggaaactgctgggtctgc SEQ ID NO 44 Pair 16 Primer 1 cgacgtggtggatgtgctagctgtgcatccactgcgcc SEQ ID NO 46 Primer 2 tgacgtggctgacctgagacctgtgcatccactgcgca SEQ ID NO 47 Pair 17 Primer 1 cgacgtggtggatgtgctagcctggagcatgagctgaccac SEQ ID NO 49 Primer 2 tgacgtggctgacetgagaccctggagcatgagctgaccaa SEQ ID NO 50 Pair 18 Primer 1 cgacgtggtggatgtgctagccatgcctcacctcctgcatt SEQ ID NO 52 Primer 2 tgacgtggctgacctgagacccatgcctcacctcctgcatc SEQ ID NO 53 Pair 19 Primer 1 cgacgtggtggatgtgctaggcatgccattgccaaattcc SEQ ID NO 55 Primer 2 tgacgtggctgacctgagacgcatgccattgccaaattct SEQ ID NO 56 Pair 20 Primer 1 cgacgtggtggatgtgctaggccaaccagacctcccagg SEQ ID NO 58 Primer 2 tgacgtggctgacctgagacgccaaccagacctcccagc SEQ ID NO 59 Pair 21 Primer 1 cgacgtggtggatgtgctaggggagacaggcccatgca SEQ ID NO 61 Primer 2 tgacgtggctgacctgagacgggagacaggcccatgct SEQ ID NO 62 Pair 22 Primer 1 cgacgtggtggatgtgctagcagaaaaggcaggaacctggaca SEQ ID NO 64 Primer 2 tgacgtggctgacctgagaccagaaaaggcaggaacctggact SEQ ID NO 65 Pair 23 Primer 1 cgacgtggtggatgtgctaggagccaagaatcgcagggaa SEQ ID NO 67 Primer 2 tgacgtggctgacctgagacgagccaagaatcgcagggat SEQ ID NO 68 Pair 24 Primer 1 cgacgtggtggatgtgctagtgtgcatgttccctggtgttca SEQ ID NO 70 Primer 2 tgacgtggctgacctgagactgtgcatgttccctggtgttct SEQ ID NO 71 Pair 25 Primer 1 cgacgtggtggatgtgctagggcatacccatgtgactaaatgttga SEQ ID NO 73 Primer 2 tgacgtggctgacctgagacggcatacccatgtgaetaaatgttgt SEQ ID NO 74 Pair 26 Primer 1 cgacgtggtggatgtgctaggcaaggcccaaagcaaagaa SEQ ID NO 76 Primer 2 tgacgtggctgacctgagacgcaaggcccaaagcaaagat SEQ ID NO 77 Pair 27 Primer 1 cgacgtggtggatgtgctagaggacagtggcttctgtactgcta SEQ ID NO 79 Primer 2 tgacgtggctgacctgagacaggacagtggcttctgtactgctt SEQ ID NO 80 Pair 28 Primer 1 cgacgtggtggatgtgctagctggaagggctttgtttgccaa SEQ ID NO 82 Primer 2 tgacgtggctgacctgagacctggaagggctttgtttgccat SEQ ID NO 83 Pair 29 Primer 1 cgacgtggtggatgtgctaggggggtactggggagaccaa SEQ ID NO 85 Primer 2 tgacgtggctgacctgagacgggggtactggggagaccat SEQ ID NO 86
• or sequences 75% homologous therewith.