Peptide
OwnerGarth J. S. Cooper, Christina M. Buchananinventors
Life of this patent
Estimating the term…
Abstract
The invention relates to a bioactive mammalian peptide. In particular, it relates to a peptide secreted by the pancreatic islet β-cell that stimulates insulin secretion termed preptin. Preptin analogs, pharmaceutical compositions which contain preptin or its analogs and their use as medicaments are inter alia also provided.
Claims105
An isolated bioactive peptide having preptin functionality.
A bioactive peptide, the amino acid sequence of which is as follows:
- 9 (SEQ ID No:1) Asp Val Ser Thr R1 R2 R3 Val Leu Pro Asp R4 Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe R5 R6 Asp Thr Trp R7 Gln Ser R8 R9 Arg Leu wherein:
- R1 is Ser or Pro;
- R2 is Gln or Pro;
- R3 is Ala or Thr;
- R4 is Asp or Asn;
- R5 is Gln or Lys;
- R6 is Tyr or Phe;
- R7 is Arg or Lys;
- R8 is Ala or Thr;
- and R9 is Gly or Gln,
- or an analog thereof.
Isolated human preptin having the amino acid sequence:
- 10 (SEQ ID No:2) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu.
- or an analog thereof.
Rat preptin having the amino acid sequence:
- 11 (SEQ ID No:3) Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Lys Phe Asp Thr Trp Arg Gln Ser Ala Gly Mg Leu.
- or an analog thereof.
Mouse preptin having the amino acid sequence:
- 12 (SEQ ID No:4) Asp Val Ser Thr Ser Gln Ala Val Leu Pro Asp Asp Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Arg Gln Ser Ala Gly Arg Leu.
- or an analog thereof.
A peptide selected from human preptin having the amino acid sequence:
- 13 (SEQ ID No:2) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg Leu.
- or an analog thereof, wherein said analog is selected from the following:
- 14 (i) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:5) Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln Arg;
- (ii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:6) Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr Gln;
- (iii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:7) Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser Thr;
- (iv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:8) Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln Ser;
- (v) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:9) Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys Gln;
- (vi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:10) Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp Lys;
- (vii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:11) Val Gly Lys Phe Phe Gln Tyr Asp Thr Trp;
- (viii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:12) Val Gly Lys Phe Phe Gln Tyr Asp Thr;
- (ix) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:13) Val Gly Lys Phe Phe Gln Tyr Asp;
- (x) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Aig Tyr Pro (SEQ ID No:14) Val Gly Lys Phe Phe Gln Tyr;
- (xi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:15) Val Gly Lys Phe Phe Gln;
- (xii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:16) Val Gly Lys Phe Phe;
- (xiii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Axg Tyr Pro (SEQ ID No:17) Val Gly Lys Phe;
- (xiv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:18) Val Gly Lys;
- (xv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:19) Val Gly;
- (xvi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro (SEQ ID No:20) Val;
- (xvii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr Pro;
- (SEQ ID No:21) (xviii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg Tyr;
- (SEQ ID No:22) (xix) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro Arg;
- (SEQ ID No:23) (xx) Asp Val Ser Tbr Pro Pro Thr Val Leu Pro Asp Asn Phe Pro;
- (SEQ ID No:24) (xxi) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp Asn Phe;
- (SEQ ID No:25) (xxii) Asp Val Ser Tbr Pro Pro Thr Val Leu Pro Asp Asn;
- (SEQ ID No:26) (xxiii) Asp Val Ser Thr Pro Pro Thr Val Leu Pro Asp;
- (SEQ ID No:27) (xxiv) Asp Val Ser Thr Pro Pro Thr Val Leu Pro;
- (SEQ ID No:28) (xxv) Asp Val Ser Thr Pro Pro Thr Val Leu;
- (SEQ ID No:29) (xxvi) Asp Val Ser Thr Pro Pro Thr Val;
- (SEQ ID No:30) (xxvii) Asp Val Ser Thr Pro Pro Tbr;
- and (SEQ ID No:31) (xxviii) Asp Val Ser Thr Pro Pro. (SEQ ID No:32)
An isolated polynucleotide which encodes human preptin and which comprises the following nucleotide sequence:
- 15 (SEQ ID No:33) gacgtgtcgacccctccgaccgtgcttccggacaacttccccagataccccgtgggcaagttettccaatatga cacctggaagcagtccacccagcgcctg.
An isolated polynucleotide which encodes rat preptin and which comprises the following nucleotide sequence:
- 16 (SEQ ID No:34) gacgtgtctacctctcaggccgtacttccggacgacttccccagtaccccgtgggcaagttcttcaaatatcgac acctggagacagtccgcgggacgcctg.
An isolated polynucleotide which encodes mouse preptin and which comprises the following nucleotide sequence:
- 17 (SEQ ID No:35) gacgtgtctacctctcaggccgtacffccggacgacttccccagataccccggggcaagttcttccatatgac acctggagacagtccgcgggacgcctg.
A preparation of mammalian preptin in which said preptin or analog is between 50% and 99% pure.
A method of modulating glucose mediated insulin secretion which comprises the step of administering to a patient an effective amount of a preptin agonist or a preptin antagonist.
An isolated polynucleotide coding for human preptin or a bioactive fragment thereof.
An isolated polynucleotide coding for human preptin analog or a bioactive fragment thereof.
An isolated polynucleotide coding for rat preptin or a bioactive fragment thereof.
An isolated polynucleotide coding for rat preptin analog or a bioactive fragment thereof.
An isolated polynucleotide coding for mouse preptin or a bioactive fragment thereof.
An isolated polynucleotide coding for mouse preptin analog or a bioactive fragment thereof.
An isolated polypeptide comprising an active fragment of preptin or an analog thereof.
A host cell comprising a vector comprising a polynucleotide which codes for preptin or an analog thereof.
A method for generating monoclonal antibodies directed against preptin comprising:
- administering preptin or a fragment thereof as an immunogen to mice;
- obtaining splenocytes from said mice;
- fusing said splenocytes with a myeloma cell line;
- and culturing the fused splenocytes in a manner which promotes production of antibodies.
Dependencies are inferred from the claim text.