Methods for diagnosis, prediction and treatment of asthma and other inflammatory conditions based on eotaxin coding sequence polymorphism
AssigneeThe Brigham and Women's Hospital, Inc.
InventorsCraig M. Lilly, Andrew D. Luster, Jeffrey M. Drazen
Life of this patent
Estimating the term…
Abstract
Methods and compositions for diagnosing and treating asthma are provided. The methods involve the discovery of a correlation between an eotaxin gene polymorphism and the ocurrence of asthma.
Claims35
A method for diagnosis of asthma including identifying a nucleic acid sequence exhibiting a polymorphism in an eotaxin gene, whereby that polymorphism comprises a substitution of adenine for guanine 67 base pairs following the ATG initiation codon of the gene, whereby counting is initiated at the A in that codon.
A method for treatment of asthma including the steps of
- A. identifying a nucleic acid sequence exhibiting a polymorphism in an eotaxin gene, whereby that polymorphism comprises a substitution of adenine for guanine 67 base pairs following the ATG initiation codon of the gene, whereby counting is initiated at the A in that codon, and
- B. remediating the substitution by replacing the adenine for guanine 67 base pairs following the ATG initiation codon of the gene, whereby counting is initiated at the A in that codon.
A compound for use in any of diagnosing, predicting and treating asthma comprising a nucleic acid substantially similar to at least a portion of a wild type (normal) exotaxin gene sequence (SEQ ID NO:
- 1) in which adenine is substituted for guanine 67 base pairs following the ATG initiation codon of the wile type gene, whereby counting is initiated at the A in that codon, and wherein said portion includes at least the foregoing substitution.
A compound for use in any of diagnosing, predicting and treating asthma comprising a nucleic acid substantially similar to at least a portion of a protein associated with a wild type (normal) exotaxin gene sequence (SEQ ID NO:
- 1) in which threonine is substituted for alanine in the 23rd position, and wherein said portion includes at least the foregoing substitution.
A compound for use in polymerase chain reaction amplification of nucleic acid sequences, the compound comprising any of the oligonucleotides:
- 6 AGAAACCACCACCTCTCACG;
- (SEQ ID NO:
- 2) GAGAATTTGCAGTGAGTCTGT;
- (SEQ ID NO:
- 3) GGGGCTTACCTGGCCCAAC;
- (SEQ ID NO:
- 4) GGGGCTTACCTGGCCCAAT;
- (SEQ ID NO:
- 5) and TCAAGGAAGGTTCTTAGATCG. (SEQ ID NO. 6)
A method for any of diagnosis, prediction and treatment of an inflammatory condition, wherein the method includes the step of identifying a nucleic acid sequence exhibiting a polymorphism in an eotaxin gene, whereby that polymorphism comprises a substitution of adenine for guanine 67 base pairs following the ATG initiation codon of the gene, whereby counting is initiated at the A in that codon.
A method for treatment of an inflammatory condition including the steps of
- A. identifying a nucleic acid sequence exhibiting a polymorphism in an eotaxin gene, whereby that polymorphism comprises a substitution of adenine for guanine 67 base pairs following the ATG initiation codon of the gene, whereby counting is initiated at the A in that codon, and
- B. remediating the substitution by replacing the adenine for guanine 67 base pairs following the ATG initiation codon of the gene, whereby counting is initiated at the A in that codon.
Dependencies are inferred from the claim text.