Cloning and characterization of the flba gene of h. pylori, production of aflagellate strains
AssigneeInstitut Pasteur and Institut National De La Sante
InventorsSEBASTIAN SUERBAUM, AGNES LABIGNE
Life of this patent
Estimating the term…
Abstract
The present application relates to nucleotide sequences which regulate the biosynthesis of the flagella proteins Helicobacter pylori, to the proteins encoded by these sequences and to aflagellate bacterial strains. The invention also relates to the use of these means for detecting an infection due to H.pylori or for protecting against such an infection.
Claims30
Nucleotide sequence which regulates the biosynthesis of the flagellar proteins of Helicobacter pylori and is able to hybridize, under conditions of high stringency, with a probe corresponding to a nucleotide fragment from H.pylori which has been amplified using two oligonucleotides having the following sequences:
- OLFlbA-1:
- ATGCCTCGAGGTCGAAAAGCAAGATG
- OLFlbA-2:
- GAAATCTTCATACTGGCAGCTCCAGTC, or able to hybridize, under conditions of high stringency, with these oligonucleotides.
Nucleotide sequence of the flbA gene which regulates the biosynthesis of the flagellar proteins of Helicobactor pylori, such as obtained by the steps of:
- screening a genomic library containing the chromosomal DNA of an H.pylori strain with a probe corresponding to a nucleotide fragment from H.pylori which has been amplified using two nucleotides having the following sequence:
- OLFlbA-1:
- ATGCCTCGAGGTCGAAAAGCAAGATG
- OLFlbA-2:
- GAAATCTTCATACTGGCAGCTCCAGTC, or able to hybridize, under conditions of high stringency, with these oligonucleotides,
- recovering the DNA sequences which hybridize with the said probe,
- subcloning the DNA sequences which have been obtained in an appropriate vector of the plasmid type and selecting those modified vectors which hybridize, under conditions of high stringency, with the probe corresponding to the DNA fragment from H.pylori which has been amplified using oligonucleotides OLFlbA-1 and OLFlbA-2,
- sequencing the DNA fragments contained in the plasmid vectors which hybridize with the abovementioned probe and determining the open reading frame contained in these fragments.
Nucleotide sequence according to any one of claims 1 to 5, which sequence is modified, by deletion, substitution or insertion of bases or of a fragment of a nucleotide sequence, such that the flbA gene is no longer expressed in a host cell or such that expression of the flbA gene in a host cell does not enable the flagella of H.pylori to be biosynthesized and, where appropriate, does not enable the hook protein of H.pylori to be synthesized.
Amino acid sequence, characterized in that it is the FlbA protein of H.pylori, having the sequence depicted in FIG. 2, or in that it is a fragment of this protein which is recognized by antibodies directed against the FlbA protein.
Dependencies are inferred from the claim text.