MAGE-A1 peptides for treating or preventing cancer
OwnerPeter Emtage, Liza Karunakaran +2inventors
InventorsPeter Emtage, Liza Karunakaran, Arthur Pedyczak, Brian H. Barber
Life of this patent
Estimating the term…
Abstract
The present invention relates to a nucleic acid encoding a polypeptide and the use of the nucleic acid or polypeptide in preventing and/or treating cancer. In particular, the invention relates to improved vectors for the insertion and expression of foreign genes encoding tumor antigens for use in immunotherapeutic treatment of cancer.
Claims27
An immunogenic peptide selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:4.
An immunogenic polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:4.
An isolated nucleic acid encoding an immunogenic peptide selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:4.
An isolated nucleic acid encoding an immunogenic peptide selected from the group consisting of:
- 8 AAAGTCCTTGAGTATGTGATCAAGGTC;
- (SEQ.ID.NO.28) TTGCAGCTGGTCTTTGGCATTGACGTG;
- (SEQ.ID.NO.29) AGTGCCTATGGGGAGCCCAGGAAGCTG;
- and, (SEQ.ID.NO.30) TGCCTAGGTCTCTCCTATGATGGCCTG. (SEQ.ID.NO.31)
An expression vector comprising a nucleic acid sequence encoding an immunogenic peptide selected from the group consisting of SEQ ID NO.:
- 1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:4.
An expression vector comprising a nucleic acid sequence encoding an immunogenic peptide selected from the group consisting of:
- 9 AAAGTCCTTGAGTATGTGATCAAGGTC;
- (SEQ.ID.NO.28) TTGCAGCTGGTCTTTGGCATTGACGTG;
- (SEQ.ID.NO.29) AGTGCCTATGGGGAGCCCAGGAAGCTG;
- and, (SEQ.ID.NO.30) TGCCTAGGTCTCTCCTATGATGGCCTG. (SEQ.ID.NO.31)
A host cell comprising a peptide selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:4.
A method for inducing an immune response in a patient comprising:
- a) obtaining autologous cells from said patient;
- b) pulsing said cells in vitro with a peptide selected from the group consisting of SEQ ID NO.:1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:4;
- and,
- c) administering the cells of step b to said patient.
A method for inducing an immune response in a patient comprising:
- a) obtaining autologous cells from said patient;
- b) transfecting said cells in vitro with a nucleic acid encoding a peptide selected from the group consisting of SEQ ID NO.:
- 1, SEQ ID NO.:2, SEQ ID NO.:3, and SEQ ID NO.:4;
- and,
- c) administering the cells of step b to said patient.
Dependencies are inferred from the claim text.