Identification of neural defects associated with the nucleosomal assembly protein 112 gene
OwnerUte Rogner, Demetri Spyropoulos +2inventors
InventorsUte Rogner, Demetri Spyropoulos, Claire Rougeulle, Philip R. Avner
Life of this patent
Estimating the term…
Abstract
A method for screening neural system defects in a human comprises: (A) providing chromosomal material from the human; (B) detecting a modification of the NAP1L2 gene in the chromosomal material, wherein the modification is selected from a) substitution, b) deletion, c) frame-shift, or d) insertion that causes a loss of biological function in the NAP1L2 gene; and (C) correlating the modification of the gene with a potential for a neural system defect. The method can also be practiced with the mouse Nap1l2 gene.
Claims53
A method for screening neural system defects in a mammal, said method comprising:
- (A) providing chromosomal material from said human;
- (B) detecting a modification of the NAP1L2 gene in the chromosomal material, wherein said modification is selected from a) substitution, b) deletion, c) frame-shift, d) insertion aberent or e) altered epigenetic control;
- that causes a loss of biological function in the NAP1L2 gene;
- and
- (C) correlating the modification of said gene with a potential for a neural system defect.
A method for screening neural system defects in a human, said method comprising:
- (A) providing biological material from said human;
- (B) detecting the absence, inappropriate, or modified expression of NAP1L2 gene product using labeled antibodies to said gene product;
- and
- (C) correlating said absence, inappropriate, or modified expression with a potential for neural system defects.
A recombinant polynucleotide comprising a nucleotide sequence, wherein said sequence includes at least one modification of the NAP1L2 gene, wherein said modification is selected from a) substitution, b) deletion, c) frame-shift, d) insertion, or e) site-directed mutagensis that causes a loss of biological function in the NAP1L2 gene.
A recombinant polynucleotide comprising a nucleotide sequence including at least the NAP1L2 gene and its promoter included in SEQ ID NO:4.
A polynucleotide comprising the promoter of the NAP1L2 gene in SEQ ID NO:4, or a polynucleotide hybridizing under stringent conditions with SEQ ID NO:4, or at least 20 nucleotides of said SEQ ID NO:
- 4.
A method of making a recombinant neural cell comprising:
- (A) providing a neural cell;
- (B) modifying a NAP1L2 gene or the promoter of the NAP1L2 gene in the neural cell, wherein said modification is selected from a) substitution, b) deletion, c) frame-shift, and d) insertion that causes a loss of biological function in the gene;
- and
- (C) selecting modified cells.
A method of screening for therapeutic compounds comprising:
- (A) providing a transgenic knockout animal containing the human NAP1L2 gene in its chromosomes.
- (B) introducing to the animal a compound to be screened;
- and
- (C) correlating a change in the development and maturation of the nervous system with the activity of the compound.
A method for screening neural system defects in a mouse, said method comprising:
- (A) providing chromosomal material from said mouse;
- (B) detecting a modification of the Nap1l2 gene in the chromosomal material, wherein said modification is selected from a) substitution, b) deletion, c) frame-shift, or d) insertion that causes a loss of biological function in the Nap1l2 gene;
- (C) correlating the modification of said gene with a potential for a neural system defect.
A method for screening neural system defects in a mouse, said method comprising:
- (A) providing biological material from said mouse;
- (B) detecting the absence, inappropriate, or modified expression of Nap1l2 gene product using labeled antibodies to said gene product;
- and
- (C) correlating said absence or inappropriate expression with a potential for neural system defects.
A recombinant polynucleotide comprising a nucleotide sequence, wherein said sequence includes at least one modification of the Nap1l2 gene, wherein said modification is selected from a) substitution, b) deletion, c) frame-shift, d) insertion, or e) site-directed mutagenesis that causes a loss of biological function in the Nap1l2 gene.
A polynucleotide comprising the promoter of the Nap1l2 gene in SEQ ID NO:1, or a polynucleotide hybridizing under stringent conditions with SEQ ID NO:
- 1, or at least 20 nucleotides of said SEQ ID NO:
- 1.
A recombinant neural cell comprising a vector comprising the Nap1l2 gene.
An eukaryotic cell containing the insert comprised in the plasmid pBPX1 or pBPX2 or pBPX3 or polynucleotide hybridizing under stringent conditions with the said insert.
A plasmid consisting in the deposit made at C.N.C.M. under the Accession Number I-2463.
A plasmid consisting in the deposit made at C.N.C.M. under the Accession Number I-2464.
A plasmid consisting in the deposit made at C.N.C.M. under the Accession Number I-2465.
A plasmid consisting in the deposit made at C.N.C.M. under the Accession Number I-2466.
A polynucleotide containing the sequence SEQ ID NO:6
- 3 (SEQ ID NO. 6) Genomic sequence BPX human 1. acttaaaggaaaaatttatctataaactgacagaatttagaaataaatacaacaatatgtaaacagttttaatatctgtg 2. atagtaacaaattctttaaatctggaaaataatagtcacttaaaattttaaaaaattgttcaattaataaatgatccaag 3. ttagaaatatgaacaaaataaacctcaccaataattactatagagaggaaattttaattactgcaaagctttccatccta 4. taaatacattatcaaatagtttaaccatttctttaatgctgagatttagattatttccaattaactcaaaagcatcaagc 5. aaatgttatgatttctaagaataaacataactttccattttggcttttgtatatatgtatatttctaacggctgttaaag 6. ccagcattaagaaggagaagcagaaagtcagtattgggactggggttatttataagccaggcaactggttaattgtggtt 7. aattgtctggtatgtttactagtcacgtagttgtatacaccatactagtttttcatcacaggccctcattcgcccccact 8. gccatcggacttcctcctcctcccctcacaggaaatgtttcgagaatttttcaacctaaaatcatatagcttgtgaaaaa 9. taccgacaaacataatatagaatatttaaataactgacacgccacctaaagaccatcagtgctaattcctggtgttttta 10. atctttgaagcgtttgtttatcagctcttccaccatccacctgtcccctccccaggtccccgatctaaaatcaaagagat 11. tgatttaggatgggtgggtgccttgtcttctctcattgttcgacattttagttacgttttctctgagctctctggaaagc 12. ataaaagtataatatctgttaaaagttggatgaatgaactaatgaacgcaatgggattccagaaaactctgcgggagatg 13. ggctagaggacgaggaggaggtggatgaatcagccatgttagagagcctgggaaggtgagcagagttgaaaacttgatag 14. atctaataatttactggctctgggtttgtcagtcactacattgcagcaaatgagattagagcatagttgtgggagggaag 15. gaggtgacgcagcaatctatttgcacctagaaattttaggcaagtgatagctgcgtaatcatactgcggcaccgtttttt 16. tcttgcagcagtagctgcttgcggaggaggtctgcccactgcagctctctgcagtctccggctctctcctgcaggatcgg 17. tcaacgcagccgtcgccgccctctgcacccagcccaggtcgccactgcttcagtccggttctcaaagcctcagcaccatc 18. ttttatccccgagcagcctggatcgtcgttccctcagtccggacgccactgctaggtccgaccaccgccacttctgatat 19. ttcggtgagtcttttcctgtggaggtttggtctcccgatctctgtggtagccaccttaggcgtgtacggtcctttgaaaa 20. ATGGCCGAGTCAGAGAACCGCAAGGAGCTGTCAGAATCCAGTCAAGAAGAGGCTGGTAATCAGATAATGGTGGAAGGGCT 21. CGGGGAACATCTGGAGCGCGGTGAAGATGCCGCTGCTGGGCTTGGAGACGATGGGAAGTGCGGTGAAGAAGCTGCCGCTG 22. GGCTTGGGGAAGAAGGGGAAAACGGTGAAGATACTGCTGCTGGGTCCGGGGAAGATGGGAAAAAAGGTGGCGATACTGAT 23. GAGGACTCAGAGGCAGACCGTCCAAAAGGACTTATCGGTTATGTTTTAGATACAGACTTTGTTGAAAGTCTACCTGTGAA 24. AGTTAAGTACCGTGTGTTAGCCCTTAAAAAGCTTCAAACTAGAGCGGCCAATTTAGAATCCAAATTCCTGAGGGAATTTC 25. ATGACATTGAAAGAAACTTTGCTGAAATGTACCAACCCTTACTGGAAAAAAGACGTCAGATCATCAATGCAATCTATGAA 26. CCTACAGAAGAGGAATGTGAATATAAATCAGACTCTGAGGACTCTGATGATGAGGAAATGTGTCATGAAGAGATGTATGG 27. TAATGAGGAGGGTATGGTACATGAATATGTGGATGAGGACGATGGTTATGAGGACTATTATTATGATTATGCTGTGGAAG 28. AGGAGGAGGAGGAGGAGGAGGAGGACGACATTGAGGCTACTGGAGAAGAGAATAAAGAAGAGGAGGATCCTAAGGGAATT 29. CCTGATTTTTGGCTAACTGTTTTAAAAAACGTTGATACACTCACTCCTTTGATTAAGAAATATGATGAGCCTATTCTGAA 30. GCTCCTGACAGATATTAAAGTTAAGCTTTCAGATCCTGGCGAGCCCCTCAGTTTCACACTAGAATTTCACTTCAAACCCA 31. ATGAATATTTCAAAAATGaGTTGTTGACAAAGACCTATGTGCTGAAGTCAAAGCTAGCATATTATGATCCCCATCCCTAT 32. AGGGGAACTGCGATTGAGTATTCCACAGGCTGTGAGATAGATTGGAATGAAGGAAAGAATGTCACTTTGAAAACCATCAA 33. GAAGAAACAGAAACATCGGATCTGGGGAACAATCCGAACTGTAACTGAAGATTTTCCCAAGGATTCATTTTTCAATTTTT 34. TCTCTCCTCATGGAATCACCTCAAATGGAAGGGATGGAAATGATGATTTTTTACTTGGTCACAATTTACGTACTTACATA 35. ATTCCAAGATCAGTATTATTTTTCTCAGGTGATGCACTGGAATCTCAGCAGGAGGGGGTAGTTAGAGAAGTTAATGATGC 36. AATTTATGACAAAATTATTTATGATAATTGGATGGCTGCAATTGAGGAACTTAAAGCTTGTTGCAAAAACCTTGAGGCAT 37. TAGTAGAAGACATTGATCGTTAGAGCagagtatacatggccctgaaattaactgccctagatatagttactcaagctata 38. agaagccttgtgttctgtattttgctttgtagtgttagttaaaacatatgtttcaaaaatataagaaaagttcaaaaact 39. aattaatttgaccttgagttttagtagtagaatgttttcaagaaatgtacactgtggtaaatgatttaaaacactagtat 40. agtgttgtgtagcttaatccttctgaagtctttttgtcatgtagctattaatctgtggctatgaaatgatcagaaatgct 41. aagtgagatcaatatttgtttggaaaaaaaatcttgggaaacaacccaagggttttcgctgttgttgtttttctttttct 42. atttttgtttacttagtcctttagctagtggatttaattttgttgtgcctgcttcattttgcaataacaatgcagtagaa 43. tttaaaacttggatgcttaagaggcctgcatatagataagaatttcaggcaaaactacatttattgttaataacagcttg 44. ttcataggctcttgtattttatgtaactgtgataaataatgaaaacttagttatattgaggttattgtttgtcggtgaag 45. tgttagtcacagtattttcaaaagtttgcacatattgttctgtgtaattgtgtaagccataattacagtgtttaattctc 46. ttttcctattacatcattcattgaaagtgatcactttaccattttgaaaagatatttcgtgttctttcactgcaaaataa 47. aaagaataaaaatttcaga
Dependencies are inferred from the claim text.