DNA assay for the prediction of autoimmune diabetes
AssigneeMcGill University
InventorsConstantin Polychronakos, Petros Vafiadis, Rosemarie Grabs, Houria Ounissi-Benkalha
Life of this patent
Estimating the term…
Abstract
The present invention relates to a novel DNA assay for the diagnosis and/or prediction of autoimmune diabetes. The present invention relates to a DNA assay for the prediction of autoimmune diabetes in human subjects, which comprises the steps of a) obtaining a DNA sample from the subject and amplifying at least one class III allele of variable number of tandem repeats (VNTR) located upstream of the insulin gene (INS) which is associated with silencing of thymic insulin mRNA expression; and b) subjecting the sample to electrophoresis to identify the silencing class III allele.
Claims13
A DNA assay for the prediction of autoimmune diabetes in human subjects where predisposition to autoimmune diabetes in a human subject is indicated by the presence of at least one Class III allele of the INS VNTR which silences thymic insulin expression, said assay comprising the steps of:
- a) obtaining a DNA sample from the subject and subjecting the sample to PCR amplification using a primer pair specific for said class III allele;
- b) subjecting the amplified sample to digestion with a restriction enzyme having a cleavage site on an uncommon variant of the repeat unit of the class III allele;
- and
- c) subjecting the digested sample to electrophoresis to identify the presence of a class III allele which silences thymic insulin expression.
An isolated Class III allele of the INS VNTR which functions to silence thymic insulin expression.
A primer pair for PCR amplification of class III alleles of variable number of tandem repeats (VNTR) located upstream of the insulin gene (INS) which comprises VNTR5 (TCAGGCTGGACCTCCAGGTGCCTGTTCTG) SEQ ID NO:2)/VNTR6 (GCTGGTCCTGAGGAAGAGGTGCTGACGA) (SEQ ID NO:3) or VNTR7(GGC ATCT TGGGCCATCCGGGACTG) (SEQ ID NO:4)/ VNTR8 (GCAGGGCG GGGCTCTTTGCGCTG) (SEQ ID NO:5).
Dependencies are inferred from the claim text.