P53-induced apoptosis

A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of:

• comparing the level of transcription of an RNA transcript in a first sample of a first tissue to the level of transcription of the transcript in a second sample of a second tissue, wherein the first tissue is suspected of being neoplastic and the second tissue is a normal human tissue, wherein the first and second tissue are of the same tissue type, and wherein the transcript is identified by a tag selected from the group consisting SEQ ID NOS:37-67;
• categorizing the first sample as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the first sample than in the second sample.

An isolated and purified nucleic acid molecule which comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

An isolated nucleotide probe comprising at least 12 contiguous nucleotides of a human nucleic acid molecule, wherein the human nucleic acid molecule comprises a SAGE tag selected from the group consisting of SEQ ID NOS:15, 16, 17, 19, 21, 22, and 30.

A method for evaluating cytotoxicity or carcinogenicity of an agent, comprising the steps of:

• contacting a test agent with a human cell;
• determining the level of transcription of a transcript in the human cell after contacting with the agent;
• wherein an agent which increases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30, or an agent which decreases the level of a transcript identified by a SAGE tag selected from the group consisting of SEQ ID NOS:37-67 is a potential cytotoxin or carcinogen.

A method to determine the neoplastic status or p53 status of a cell comprising:

• comparing ROS levels in a first sample of a first tissue to the level in a second sample of a second tissue, wherein the first tissue is or is suspected of being neoplastic and the second tissue is a normal human tissue;
• wherein elevated levels of ROS in the first sample indicate expression of p53 and low levels of ROS indicate lack of expression of p53, wherein lack of expression of p53 is an indicator of neoplasia.

A DNA construct for screening drugs as anti-neoplastic agents comprising:

• a reporter gene under the control of a PIG-3 promoter, wherein the reporter gene is 3′ and covalently linked to the PIG-3 promoter, wherein the PIG-3 promoter comprises the sequence CAGCTTGCCCACCCATGCTC (SEQ ID NO:1).

A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of;

• treating cells of a test sample with a DNA-damaging agent;
• comparing the level of transcription of an RNA transcript in cells of the sample to the level of transcription of the transcript in cells of the sample which are not subject to said treating, wherein the transcript is identified by a tag selected from the group consisting of SEQ ID NOS:10, 15-22, 26, 27, and 30;
• categorizing the sample as neoplastic or as having a mutant p53 when transcription is found to be the same or lower in the treated cells than in the untreated cells.

A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of:

• treating cells of a test sample with a DNA-damaging agent;
• comparing the level of transcription of an RNA transcript in the cells to the level of transcription of the transcript in cells of the sample which are not subject to said treating, wherein the transcript is identified by a tag selected from the group consisting of SEQ ID NOS:37-67;
• categorizing the sample as neoplastic or as having a mutant p53 when transcription is found to be the same or higher in the treated cells than in the untreated cells.

A preparation of antibodies which specifically bind to a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:81, 83, 84, 86, 87, and 88.

A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of:

• comparing the level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 in a first sample of a first tissue to the level of the PIG protein in a second sample of a second tissue, wherein the first tissue is suspected of being neoplastic and the second tissue is a normal human tissue, wherein the first and second tissue are of the same tissue type;
• and
• categorizing the first sample as neoplastic or as having a mutant p53 when the level of the PIG protein is found to be the same or lower in the first sample than in the second sample.

A method of diagnosing cancer or determining p53 status in a sample suspected of being neoplastic, comprising the steps of:

• comparing the level of a protein of Table 2 in a first sample of a first tissue to the level of the protein of Table 2 in a second sample of a second tissue, wherein the first tissue is suspected of being neoplastic and the second tissue is a normal human tissue, wherein the first and second tissue are of the same tissue type;
• and
• categorizing the first sample as neoplastic or as having a mutant p53 when the level of the protein of Table 2 is found to be the same or higher in the first sample than in the second sample.

A method for evaluating cytotoxicity or carcinogenicity of an agent, comprising the steps of:

• contacting a test agent with a human cell;
• determining the level of a PIG protein having an amino acid sequence selected from the group consisting of SEQ ID NOS:79-88 and the amino acid sequence encoded by SEQ ID NO:72 or of a protein of Table 2 in the human cell after contacting with the agent;
• wherein an agent which increases the level of the PIG protein, or an agent which decreases the level of the protein of Table 2 is identified as a potential cytotoxin or carcinogen.