Methods of sequencing antibody chains from hybridomas and kits for practicing same

A method of sequencing the variable regions of a human monoclonal antibody produced by a hybridoma cell line, wherein the human monoclonal antibody comprises a heavy chain and a kappa light chain, the method comprising:

• (a) annealing in a first reaction tube a heavy chain constant region-specific reverse transcription primer to the constant region of heavy chain transcripts extracted from cells of the hybridoma cell line, wherein the heavy chain transcripts encode the heavy chain constant and variable regions of the human monoclonal antibody;
• (b) extending the heavy chain constant region-specific reverse transcription primer using a reverse transcriptase to synthesize a heavy chain complementary DNA (cDNA), wherein the heavy chain cDNA comprises a 3′ overhang produced by the reverse transcriptase;
• (c) annealing a template switch oligonucleotide comprising a primer sequence to the 3′ overhang and extending the 3′ end of the heavy chain cDNA using the template switch oligonucleotide as template;
• (d) performing second strand synthesis on the heavy chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (c) to produce a double-stranded heavy chain cDNA;
• (e) PCR amplifying the double-stranded heavy chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (c) and a human heavy chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (b) to produce heavy chain cDNA amplicons, wherein
• the human heavy chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (b) consists of the nucleotide sequence agggcgcctgagttccacg (SEQ ID NO:
• 12);
• (f) annealing in a second reaction tube a human light chain constant region-specific reverse transcription primer to the constant region of human light chain transcripts extracted from cells of the hybridoma cell line, wherein the light chain transcripts encode the human light chain constant and variable regions of the human monoclonal antibody;
• (g) extending the human light chain constant region-specific reverse transcription primer using a reverse transcriptase to synthesize a light chain cDNA, wherein the light chain cDNA comprises a 3′ overhang produced by the reverse transcriptase;
• (h) annealing a template switch oligonucleotide comprising a primer sequence to the 3′ overhang and extending the 3′ end of the light chain cDNA using the template switch oligonucleotide as template;
• (i) performing second strand synthesis on the light chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (h) to produce a double-stranded light chain cDNA;
• (j) PCR amplifying the double-stranded light chain cDNA using a primer comprising the primer sequence of the template switch oligonucleotide annealed at step (h) and a human light chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (g) to produce light chain cDNA amplicons, wherein
• the human light chain constant region-specific primer that anneals to a sequence nested within the cDNA sequence synthesized during step (g) consists of the nucleotide sequence tttggcctctctgggatagaag (SEQ ID NO:
• 11);
• and
• (k) performing Sanger sequencing on the heavy chain cDNA amplicons and the kappa chain cDNA amplicons, thereby sequencing the variable regions of the human monoclonal antibody produced by the hybridoma cell line.