RNA G-quadruplex structure in pre-miRNA-1229 as a therapeutic target for Alzheimer's disease and various cancers
AssigneeDuquesne University of the Holy Spirit
InventorsMihaela Rita Mihailescu, Joshua A. Imperatore
Life of this patent
Estimating the term…
Abstract
Provided is an agent that binds to a wild type or variant pre-miRNA-1229 comprising a G-quadruplex (GQ) structure, wherein binding of the agent to the wild type or variant pre-miRNA-1229 stabilizes the GQ structure of the wild type or variant pre-miRNA-1229. In some embodiments, the variant is rs2291418. Provided is a method of treating a disease in a subject, comprising: administering a therapeutically effective amount of the agent to the subject. In some embodiments, the disease is Alzheimer's disease, cancer or coronary artery calcification.
Claims2
An agent that binds to a wild type or variant pre-miRNA-1229 comprising a G-quadruplex (GQ) structure, wherein binding of the agent to the wild type or variant pre-miRNA-1229 stabilizes the GQ structure of the wild type or variant pre-miRNA-1229,wherein the agent consists of an oligonucleotide sequence comprising 2′-deoxy 2′-fluoroarabino oligonucleotides consisting of:
- GGGUGUCCCUGAACCCCAGC (SEQ ID NO:10), wherein the variant is rs2291418.
Dependencies are inferred from the claim text.