One-step method for producing adenoviral vectors
AssigneeThe University of Chicago
InventorTong-Chuan He
Life of this patent
Estimating the term…
Abstract
The disclosure is directed to a gene transfer vector which comprises (i) all or part of a viral genome and (ii) a suicide gene flanked by unique cloning sequences. The disclosure also is directed to a system for producing an adenoviral vector comprising a destination vector comprising (i) all or part of an adenoviral genome and (ii) a suicide gene flanked by unique cloning sequences; a transgene flanked by unique cloning sequences; and (c) reagents for Gibson DNA Assembly (GDA). A method of producing an adenoviral vector using the aforementioned system also is provided.
Claims11
A gene transfer vector comprising (i) all or part of a viral genome, wherein the viral genome does not comprise an E1 region and (ii) a suicide gene flanked by a first cloning nucleic acid sequence and a second cloning nucleic acid sequence, wherein the first cloning nucleic acid sequence comprises SEQ ID NO:
- 1 (AATCGGAAAGCGGACGCGGA) and the second cloning nucleic acid sequence comprises SEQ ID NO:
- 2 (CGAGTATCCCGTGAGCGCTT).
A system for producing an adenoviral vector, which comprises:
- (a) a vector comprising (i) all or part of an adenoviral genome, wherein the viral genome does not comprise an E1 region and (ii) a suicide gene flanked by a first cloning nucleic acid sequence and a second cloning nucleic acid sequence, wherein the first cloning nucleic acid sequence comprises SEQ ID NO:
- 1 (AATCGGAAAGCGGACGCGGA) and the second cloning nucleic acid sequence comprises SEQ ID NO:
- 2 (CGAGTATCCCGTGAGCGCTT) wherein the first and second cloning nucleic acid sequences are different;
- (b) a transgene flanked by the first cloning nucleic acid sequence and the second cloning nucleic acid sequence;
- and
- (c) reagents for isothermal DNA assembly.
Dependencies are inferred from the claim text.