Back to results
US 12,662,669 B2Granted
RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
AssigneeUniversity of Massachusetts
InventorsChristian Mueller, Robert H. Brown, Jr.
Life of this patent
Estimating the term…
Abstract
The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis.
Claims20
A method of treating a subject having or suspected of having ALS, the method comprising:
- administering to the subject an effective amount of a recombinant adeno-associated virus (rAAV) harboring a nucleic acid that is engineered to express, in a cell of the subject, a miRNA that targets RNA encoded by a SOD1 gene,
- wherein the miRNA comprises 21 continuous nucleotides encoded by a sequence set forth in SEQ ID NO:
- 17:
- CTGCATGGATTCCATGTTCAT (SOD-miR-127),
- wherein the rAAV comprises an AAV.Rh10 capsid protein.
2 more elements
A recombinant nucleic acid comprising a sequence set forth in 21 consecutive nucleotides of SEQ ID NO:
- 17, flanking regions of miR-155, and further comprising an inverted terminal repeat (ITR) of AAV2.
A recombinant Adeno-Associated Virus (AAV) comprising a recombinant nucleic acid encoding a miRNA comprising 21 consecutive nucleotides encoded by a sequence as set forth in SEQ ID NO:
- 17, flanking regions of miR-155, and further comprising a capsid protein of AAV.Rh10.
Dependencies are inferred from the claim text.