RNA-guided human genome engineering
AssigneePresident and Fellows of Harvard College
InventorsGeorge M. Church, Prashant G. Mali, Luhan Yang
Life of this patent
Estimating the term…
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims24
An RNA-guided system for use in a eukaryotic cell comprising
- (1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
- (2) a Cas9 nickase or a nuclease null Cas9, or a second nucleic acid sequence encoding the Cas9 nickase or the nuclease null Cas9,
- wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising the sequence
- (SEQ ID NO:
- 46)
- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA
- CUUGAAAAAGUGGCACCGAGUCGGUGC.
A method of altering a eukaryotic cell comprising
- providing the eukaryotic cell with a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence, wherein the guide RNA sequence comprises a spacer sequence complementary to genomic DNA of the eukaryotic cell, and a scaffold sequence,
- providing the eukaryotic cell with a Cas9 nickase, or a second nucleic acid sequence encoding the Cas9 nickase,
- wherein the guide RNA sequence binds to complementary genomic DNA and the Cas9 nickase nicks the complementary genomic DNA, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising the sequence
- (SEQ ID NO:
- 46)
- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA
- CUUGAAAAAGUGGCACCGAGUCGGUGC.
Dependencies are inferred from the claim text.