Universal lactic acid bacteria quantification kit for fermentation monitoring

A method for quantification of Lactobacillus, Pediococcus and Weissella bacteria, or one or some sub-combination thereof, in a sample of interest, suspected of containing lactic acid bacteria (LAB) nucleic acid comprising:

• obtaining the sample of interest from an ethanol fermentation tank or a corn mash sampling;
• and,
• performing a nucleic acid based amplification assay and nucleic acid quantification of one or some sub-combination of Lactobacillus, Pediococcus and Weissella bacteria of the sample of interest, wherein the nucleic acid based amplification assay provides:
• i) a forward primer having a nucleotide sequence selected from the group consisting of lactic acid bacteria (LAB) hybridizing sequence consisting of at least 80% to sequence identity GGAGGCAGCAGTAGGGAATC (SEQ ID NO:
• 1)
• ii) a reverse primer having a nucleotide sequence selected from the group consisting of an LAB hybridizing sequence consisting of at least 80% sequence identity to ACCGCTACACATGGAGTTCC (SEQ ID NO:
• 6) and,
• iii) a PCR probe comprising a fluorophore, at least one quencher, and an oligonucleotide having a nucleotide sequence of at least 80% sequence identity to one of GCGGTAATACGTAGGTGGCA (SEQ ID NO:
• 4) or GCGGTAATACGTATGTTCCA (SEQ ID NO:
• 9).