Compositions for herpesvirus transcriptional feedback circuit disruption and uses thereof
AssigneeThe J. David Gladstone Institutes, a testamentary trust established under the Will of J. David Gladstone
InventorsLeor S. Weinberger, Sonali Chaturvedi
Life of this patent
Estimating the term…
Abstract
The present disclosure provides compositions and methods for inhibiting herpesvirus replication in a cell infected with herpesvirus. The composition includes a double stranded DNA molecule including a sequence of a cis regulatory sequence (crs) of a herpesvirus, wherein the crs is flanked on 5′ end by a first sequence of at least 2 base pairs and on the 3′ end by a second sequence of at least 2 base pairs.
Claims10
A composition comprising a double stranded DNA molecule comprising a cis regulatory sequence (crs) of the herpesvirus, wherein the crs is flanked on the 5′ end by a first sequence of at least 2 base pairs and on the 3′ end by a second sequence of at least 2 base pairs, wherein the herpesvirus is HCMV and the sequence of the herpesvirus crs comprises CGTTTAGTGAACCG (SEQ ID NO:
- 4), wherein the sequence of the herpesvirus crs flanked on the 5′ end by a first sequence of at least 2 base pairs and on the 3′ end by a second sequence of at least 2 base pairs comprises GACAGATCGTTTAGTGAACCGTACACGA (SEQ ID NO:
- 1).
A composition comprising a double stranded DNA molecule comprising a cis regulatory sequence (crs) of the herpesvirus, wherein the crs is flanked on the 5′ end by a first sequence of at least 2 base pairs and on the 3′ end by a second sequence of at least 2 base pairs, wherein the herpesvirus is HCMV and the sequence of the herpesvirus crs comprises CGTTTAGTGAACCG (SEQ ID NO:
- 4), wherein the sequence of the herpesvirus crs flanked on the 5′ end by a first sequence of at least 2 base pairs and on the 3′ end by a second sequence of at least 2 base pairs comprises G*ACAGATCGTT*TAGTGAACC*GTACACG*A (SEQ ID NO:
- 5), wherein * is a phosphorothioated bond.
Dependencies are inferred from the claim text.