Compositions and methods for suppressing intracellular synthesis of the beta subunit of human chorionic gonadotropin
AssigneeJames Summerton Living Trust dated May 15, 2008
InventorsJanet Helena Kinion, James E. Summerton
Life of this patent
Estimating the term…
Abstract
A composition of matter includes an antisense phosphorodiamidate morpholino oligomer (MO) that includes an MO base sequence. The MO base sequence is arranged to bind a corresponding complementary base sequence of messenger RNA (mRNA) transcribed from one or more genes for the beta subunit of human chorionic gonadotropin (hCG-β). An inventive method, for suppressing intracellular synthesis of a beta subunit of human chorionic gonadotropin (hCG-β), includes introducing such an MO into one or more cells.
Claims16
A composition of matter comprising an antisense phosphorodiamidate morpholino oligomer (MO) that includes an MO base sequence, the MO base sequence being arranged to bind a corresponding complementary base sequence of messenger RNA (mRNA) transcribed from one or more genes for a beta subunit of human chorionic gonadotropin (hCG-β), wherein the MO base sequence is gcagcagcccctggaacatctccatc (SEQ ID NO:
- 1).
A method for suppressing intracellular synthesis of a beta subunit of human chorionic gonadotropin (hCG-β), the method comprising introducing into one or more cells an antisense phosphorodiamidate morpholino oligomer (MO) that includes an MO base sequence, the MO base sequence being arranged to bind a corresponding complementary base sequence of messenger RNA (mRNA) transcribed from one or more genes for the beta subunit of human chorionic gonadotropin (hCG-β), wherein the MO base sequence is gcagcagcccctggaacatctccatc (SEQ ID NO:
- 1).
Dependencies are inferred from the claim text.