Back to results
US 12,576,100 B2Granted
Nucleic acid agents modulating SLAMF6 isoforms
AssigneeHadasit Medical Research Services and Development Ltd.
InventorsMichal Lotem, Emma Hajaj, Galit Eisenberg
Life of this patent
Estimating the term…
Abstract
The invention relates to nucleic acid agents modulating the expression of SLAMF6 isoforms, compositions comprising same and methods for their use in immunomodulation. Specifically, provided are splice-switching oligonucleotides and constructs useful in cancer immunotherapy.
Claims21
A SLAMF6 expression-modulating oligonucleotide of 15-30 nucleotides in length, which is a splice-switching oligonucleotide having the nucleic acid sequence of GGGUACUAUGAAGGCAAGAG (SEQ ID NO:
- 1) or UCAUGGGGUACUAUGAAGGC (SEQ ID NO:2), and wherein said oligonucleotide is a single-stranded RNA molecule, optionally derivatized by one or more backbone and/or sugar chemical modifications.
Dependencies are inferred from the claim text.