Compositions and methods for inhibiting cytochrome P450 family 7 subfamily a member 1 (CYP7A1) expression
AssigneeTakeda Pharmaceutical Company Limited
InventorsBernard Allan, Brian Ko, Pawan Kumar, Naim Nazef, Jason Pickens
Life of this patent
Estimating the term…
Abstract
RNAi agents (e.g., CYP7A1 RNAi agents) for inhibiting the expression of the CYP7A1 gene, compositions including the RNAi agents conjugated to a targeting moiety, and methods of use are described. Also disclosed are pharmaceutical compositions including one or more RNAi agents (e.g., CYP7A1 RNAi agents). Delivery of the RNAi agent(s) to liver cells in vivo inhibits CYP7A1 gene expression and treats a CYP7A1 disease or a CYP7A1-associated disease.
Claims27
An RNAi agent for inhibiting expression of Cytochrome P450 family 7 subfamily A member 1 (CYP7A1) in a cell, wherein the RNAi agent comprises a sense strand and an antisense strand forming a duplex region, wherein the antisense strand comprises the nucleobase sequence (5′→3′) of UCAAGAAUAAGCCAUAGACAAAG (SEQ ID NO:
- 1180), and wherein the sense strand is 19-23 nucleosides in length and is at least substantially complementary to the antisense strand.
A conjugate comprising a Cytochrome P450 family 7 subfamily A member 1 (CYP7A1) RNAi agent covalently linked to a targeting moiety, wherein the CYP7A1 RNAi agent comprises a sense strand and an antisense strand, wherein the antisense strand comprises the nucleobase sequence of SEQ ID NO:
- 1180 and a structure (5′→3′) of
- [mUs][fCs][fA][mA][fG][fA][fA][fU][mA][fA][mG][mC][mC][fA][mU][mA][mG][mA][mC][mA][mAs][mAs][mG] (SEQ ID NO:
- 2029);
- and
- wherein the sense strand comprises the nucleobase sequence of SEQ ID NO:
- 404 and a structure (5′→3′) of
- [mUs][mUs][mG][mU][mC][mU][mA][mU][fG][fG][fC][fU][mU][mA][mU][mU][mC][mU][mU][mG][mAs] (SEQ ID NO:
- 1202);
- wherein:
- mA, mC, mG, and mU are 2′-O-methyl adenosine, cytidine, guanosine, and uridine, respectively;
- fA, fC, fG, and fU are 2′-fluoro adenosine, cytidine, guanosine, and uridine, respectively;
- and s is a phosphorothioate linkage;
- wherein the targeting moiety is covalently linked to the 3′ terminal nucleoside of the sense strand and the s of the 3′-terminal [mAs] of the sense strand corresponds to the phosphorothioate linkage of a first repeat unit of the targeting moiety, wherein the conjugate comprises a structure of:
- or a pharmaceutically acceptable salt thereof.
Dependencies are inferred from the claim text.