Back to results
US 12,534,769 B2Granted
Primer sets for the detection of human papillomavirus type 16 (HPV16) and human papillomavirus type 18 (HPV18), the method of detecting HPV16 and HPV18 infections, the use of a primer set for the detection of HPV16 and HPV18 infections
AssigneeGenomtec S.A.
InventorsMalgorzata Malodobra-Mazur, Miron Tokarski, Izabela Pielka
Life of this patent
Estimating the term…
Abstract
The first object of the invention is primer sets for amplifying the nucleotide sequence of the L2 gene of human papillomavirus type 16 or L1 gene of human papillomavirus type 18. The second object of the invention is a method for detecting HPV16 or HPV18 viruses. Another object of the invention is a method of detecting HPV16 and HPV18 infections. A fourth object of the invention is a kit for detecting HPV16 or HPV18 infections.
Claims11
A primer set for amplifying the nucleotide sequence of the L2 gene of human papillomavirus type 16 (HPV16) or L1 gene of human papillomavirus type 18 (HPV18), comprising:
- a) an internal primer set for HPV16 with the following nucleotide sequences:
- a primer with the nucleotide sequence 5′ CATGCAAACAGGCAGGTA 3′ (SEQ ID NO:
- 3) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 3, linked by a TTTT bridge to the sequence 5′ ATTTGATCAGCAATAGTTTTGCCTT 3′-(SEQ ID NO:
- 5) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 5, and
- a primer with the nucleotide sequence 5′ ATATACCCAGTGCGTCCG 3′-(SEQ ID NO:
- 4) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 4, linked by a TTTT bridge with the sequence 5′ GGAAGTATGGGTGTATTTTTTGGTG 3′-(SEQ ID NO:
- 6) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 6;
- and
- b) an external primer set for HPV16 with the following nucleotide sequences:
- a primer with the nucleotide sequence 5′ AAAACGTGCATCGGCTAC 3′ (SEQ ID NO:
- 1) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 1, and
- a primer with the nucleotide sequence 5′ GAGGCCTTGTTCCCAATG 3′ (SEQ ID NO:
- 2) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 2;
- or
- c) an internal primer set for HPV18 with the following nucleotide sequences
- a primer with the nucleotide sequence 5′ CCCTATTTTTTTGCAGATGGC 3′ (SEQ ID NO:
- 9) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 9, linked by a TTTT bridge with the nucleotide sequence 5′ AGGAGGTGGAAGATATACGGTATT 3′ (SEQ ID NO:
- 11) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 11, and
- a primer with the nucleotide sequence 5′ CCAACAGTTAATAATCTAGAGCT 3′-(SEQ ID NO:
- 10) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 10, linked by a TTTT bridge with the sequence 5′ GGCAAGAGTTGTAAATACCGATGA 3′ (SEQ ID NO:
- 12) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 12, and
- d) an external primer set for HPV18 with the following nucleotide sequences:
- a primer with the nucleotide sequence 5′ CCTAAGAAACGTAAACGTGTT 3′ (SEQ ID NO:
- 7) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 7, and
- a primer with the nucleotide sequence 5′ CAGGAACCCTAAAATATGGATT 3′ (SEQ ID NO:
- 8) or a sequence resulting from a single nucleotide exchange, single nucleotide substitution, or single nucleotide deletion of SEQ ID NO:
- 8.
35 more elements
Dependencies are inferred from the claim text.