RNAi agents for inhibiting expression of inhibin subunit beta E (INHBE), pharmaceutical compositions thereof, and methods of use

An RNAi agent for inhibiting expression of an Inhibin Subunit Beta E (INHBE) gene, comprising:

• an antisense strand wherein nucleotides 1-21 of the antisense strand 5′→3′) comprise the nucleotide sequence (5′→3′):
• usAfsuuAfagaaagUfaUfaAfgccassg (SEQ ID NO:
• 391), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine;
• Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine;
• s represents a phosphorothioate linkage, and ss represents a phosphorodithioate linkage;
• and
• a sense strand comprising the nucleotide sequence (5′→3′):
• CUGGCUUAUACUUUCUUAAUA (SEQ ID NO:
• 684);
• wherein all of the nucleotides of the sense strand are modified nucleotides, wherein the modified nucleotides are selected from the group consisting of 2′-fluoro modified nucleotides and 2′-O-methyl modified nucleotides.