Method for constructing gE protein-deleted pseudorabies virus strain using adenine base editor and use thereof

A gE protein-deleted pseudorabies virus (PRV) strain, the gE protein-deleted PRV strain being deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO:

• V202323;
• and the gE protein-deleted PRV strain being constructed using an adenine base editor (ABE);
• (ABE) and
• wherein the gE protein-deleted PRV strain is constructed using a process comprising:
• (1), constructing an sgRNA backbone plasmid, comprising:
• designing an sgRNA sequence having the sequence set forth in SEQ ID NO:
• 2, using the ABE with a start codon of the gE gene in a PRV as a target site, synthesizing two single-stranded oligonucleotides according to the sgRNA sequence, annealing the single-stranded oligonucleotides to obtain a double-stranded DNA fragment with sticky ends, digesting a vector with a restriction endonuclease and recovering a resulting enzyme-digested fragment, and then ligating the enzyme-digested fragment to the double-stranded DNA fragment with sticky ends to obtain a ligation product, namely an sgRNA expression vector;
• wherein the single-stranded oligonucleotide has the sequences set forth in SEQ ID NO:
• 3 or SEQ ID NO:
• 4:
• NG-ABE8e-gE-F:
• CACCGGCCGCATGGTCTCAACCCC (SEQ ID NO:
• 3);
• NG-ABE8e-gE-R:
• AAACGGGGTTGAGACCATGCGGCC (SEQ ID NO:
• 4);
• the vector has the sequence set forth in SEQ ID NO:
• 11;
• the restriction endonuclease is a BbsI enzyme;
• and
• transforming the ligation product into a competent cell to allow plate screening and culture, selecting a resulting positive bacterial strain to allow expanded culture, and extracting a resulting plasmid from a resulting positive bacterial solution;
• and
• (2), transfection of the plasmid, comprising:
• introducing the plasmid into a Vero81 cell, culturing the Vero81 cell to logarithmic growth phase at 37° C. and 5% (v/v) CO2, collecting a resulting virus liquid, and centrifuging the virus liquid to collect a resulting supernatant;
• wherein the adenine base editor is NG-ABE8e;
• and
• wherein a base at position 2 of a start codon in the gE gene of wild-type PRV is mutated from T to C to obtain a resulting mutated gE gene;
• wherein the resulting mutated gE gene is set forth in SEQ ID NO:
• 1.