Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy
AssigneeDyne Therapeutics, Inc.
InventorsRomesh R. Subramanian, Mohammed T. Qatanani, Timothy Weeden
Life of this patent
Estimating the term…
Abstract
Aspects of the disclosure relate to complexes comprising a muscle-targeting agent covalently linked to a molecular payload. In some embodiments, the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. In some embodiments, the molecular payload promotes the expression or activity of a functional dystrophin protein. In some embodiments, the molecular payload is an oligonucleotide, such as an antisense oligonucleotide, e.g., an oligonucleotide that causes exon skipping in a mRNA expressed from a mutant DMD allele.
Claims30
A composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide,
- wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions;
- wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO:
- 1;
- wherein each oligonucleotide of the complexes is 30 nucleotides in length and comprises a region of complementarity of 25, 26, 27, 28, 29, or 30 nucleotides in length, wherein the region of complementarity is complementary to the annealing site of an oligonucleotide consisting of the sequence of SEQ ID NO:
- 195, wherein each oligonucleotide of the complexes is a phosphorodiamidate morpholino oligomer (PMO);
- and
- wherein, for each complex, each oligonucleotide of the complex is independently covalently linked at its 5′ end to a lysine residue of the anti-transferrin receptor antibody of the complex via a cleavable linker comprising a valine-citrulline sequence.
A method of treating Duchenne muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide,
- wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions;
- wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO:
- 1;
- wherein each oligonucleotide of the complexes is 30 nucleotides in length and comprises a region of complementarity of 25, 26, 27, 28, 29, or 30 nucleotides in length, wherein the region of complementarity is complementary to the annealing site of an oligonucleotide consisting of the sequence of SEQ ID NO:
- 195, wherein each oligonucleotide of the complexes is a phosphorodiamidate morpholino oligomer (PMO);
- and
- wherein, for each complex, each oligonucleotide of the complex is independently covalently linked at its 5′ end to a lysine residue of the anti-transferrin receptor antibody of the complex via a cleavable linker comprising a valine-citrulline sequence.
A composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide,
- wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions;
- wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO:
- 1;
- wherein each oligonucleotide is 30 nucleotides in length, wherein each oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO:
- 296);
- and
- wherein, for each complex, each oligonucleotide is independently covalently linked at its 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence.
A method of treating Duchenne muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a composition comprising complexes that comprise an anti-transferrin receptor antibody covalently linked to at least one exon-skipping oligonucleotide,
- wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions;
- wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO:
- 1;
- wherein each oligonucleotide is 30 nucleotides in length, wherein each oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO:
- 296);
- and
- wherein, for each complex, each oligonucleotide is independently covalently linked at its 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence.
Dependencies are inferred from the claim text.