# US 12,180,503 B2 · Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription > Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt - Number: US 12,180,503 B2 - Document ID: US12180503B2 - Status: Granted - Kind: B2 - Application number: 17/348,596 - Filed: 2021-06-15 - Published: 2021-12-16 - Granted: 2024-12-31 - Earliest claimed: 2012-05-25 - Assignees: The Regents of the University of California; University of Vienna; Emmanuelle Charpentier - Applicants: The Regents of the University of California; University of Vienna; Emmanuelle Charpentier - Inventors: Jennifer A. Doudna; Martin Jinek; Krzysztof Chylinski; Emmanuelle Charpentier - Web page: https://patentgrep.com/patent/US12180503B2 ## CPC - C12N 15/907: {in mammalian cells} - A01H 6/4684: {Zea mays [maize]} - A01K 67/027: New or modified breeds of vertebrates - A61K 38/465: {acting on ester bonds (3.1), e.g. lipases, ribonucleases} - A61P 31/00: Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics - A61P 31/04: Antibacterial agents - A61P 31/12: Antivirals - A61P 35/00: Antineoplastic agents - A61P 43/00: Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 - C12N 9/226: {Class 2 CAS enzyme complex, e.g. single CAS protein} - C12N 15/102: {Mutagenizing nucleic acids} - C12N 15/111: {General methods applicable to biologically active non-coding nucleic acids} - C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} - C12N 15/63: Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression - C12N 15/70: Vectors or expression systems specially adapted for E. coli - C12N 15/746: {for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)} - C12N 15/90: Stable introduction of foreign DNA into chromosome - C12N 15/902: {using homologous recombination} - C12Q 1/686: Polymerase chain reaction [PCR] - H10H 20/0137: {the light-emitting regions comprising nitride materials} - H10P 14/20: of semiconductor materials - H10P 14/6512: {by exposure to a gas or vapour} - A61K 48/00: Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy - C12N 9/22: Ribonucleases {[RNase]; Deoxyribonucleases [DNase]} - C12N 2310/11: Antisense - C12N 2310/13: Decoys - C12N 2310/14: interfering nucleic acids [NA] - C12N 2310/20: involving clustered regularly interspaced short palindromic repeats [CRISPR] - C12N 2310/31: of the backbone - C12N 2310/32: of the sugar - C12N 2310/33: of the base - C12N 2310/3519: Fusion with another nucleic acid - C12N 2310/531: Stem-loop; Hairpin - C12N 2800/80: Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites - C12Y 301/04: Phosphoric diester hydrolases (3.1.4) - Y02A 50/30: Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change - C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00) - A01H: NEW PLANTS OR {NON-TRANSGENIC} PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES - A01K: ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS - A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D) - A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS - C12Q: MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS (immunoassay G01N33/53); COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES - H10H: INORGANIC LIGHT-EMITTING SEMICONDUCTOR DEVICES HAVING POTENTIAL BARRIERS - H10P: GENERIC PROCESSES OR APPARATUS FOR THE MANUFACTURE OR TREATMENT OF DEVICES COVERED BY CLASS H10 - C12Y: ENZYMES - Y02A: TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE ## Abstract The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms. ## Claims ### Claim 1 A composition comprising: (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and (b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order: (i) a targeter-RNA comprising: (1) a first nucleotide sequence that hybridizes with a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and (ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA. ### Claim 2 (depends on 1) The composition of claim 1, wherein the first nucleotide sequence comprises 18 to 25 nucleotides that hybridize with the target sequence. ### Claim 3 (depends on 1) The composition of claim 1, wherein the first and second nucleotide sequences are heterologous to one another. ### Claim 4 (depends on 1) The composition of claim 1, wherein said intervening nucleotides are 3-5 nucleotides. ### Claim 5 (depends on 1) The composition of claim 1, wherein said intervening nucleotides are 5-10 nucleotides. ### Claim 6 (depends on 1) The composition of claim 1, wherein said intervening nucleotides are 10-20 nucleotides. ### Claim 7 (depends on 1) The composition of claim 1, wherein said intervening nucleotides are 20-40 nucleotides. ### Claim 8 (depends on 1) The composition of claim 1, said intervening nucleotides are 4 nucleotides. ### Claim 9 (depends on 1) The composition of claim 1, further comprising a nuclease inhibitor and/or a buffering agent. ### Claim 10 (depends on 1) The composition of claim 1, wherein the composition is sterile. ### Claim 11 (depends on 1) The composition of claim 1, further comprising a reducing agent. ### Claim 12 (depends on 1) The composition of claim 1, wherein the composition comprises a salt. ### Claim 13 (depends on 1) The composition of claim 1, wherein the composition comprises one or more salts selected from: NaCl, MgCl2, KCl, and MgSO4. ### Claim 14 (depends on 1) The composition of claim 1, further comprising a donor polynucleotide. ### Claim 15 (depends on 1) The composition of claim 1, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain. ### Claim 16 (depends on 1) The composition of claim 1, wherein the Cas9 protein comprises a heterologous polypeptide. ### Claim 17 (depends on 16) The composition of claim 16, wherein the heterologous polypeptide comprises an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, or green fluorescent protein. ### Claim 18 (depends on 1) The composition of claim 1, wherein the Cas9 protein is fused to a protein transduction domain (PTD). ### Claim 19 (depends on 1) The composition of claim 1, wherein a protein transduction domain (PTD) is covalently linked to the amino terminus (N-terminus) of the Cas9 protein. ### Claim 20 (depends on 1) The composition of claim 1, wherein a protein transduction domain (PTD) is covalently linked to the carboxyl terminus (C-terminus) of the Cas9 protein. ### Claim 21 (depends on 1) The composition of claim 1, wherein the composition comprises a protein-RNA complex comprising the Cas9 protein and the single molecule DNA-targeting RNA. ### Claim 22 (depends on 1) The composition of claim 1, comprising the single molecule DNA-targeting RNA and the nucleic acid encoding the Cas9 protein. ### Claim 23 (depends on 1) The composition of claim 1, wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUUUUU (SEQ ID NO: 432); or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441). ### Claim 24 (depends on 1) The composition of claim 1, comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more non-natural internucleoside linkages, one or more nucleic acid mimetics, one or more modified sugar moieties, one or more modified nucleobases, or any combination thereof. ### Claim 25 (depends on 7) The composition of claim 7, wherein the single molecule DNA-targeting RNA comprises said one or more non-natural internucleoside linkages and/or said one or more modified sugar moieties. ### Claim 26 (depends on 1) The composition of claim 1, comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more phosphorothioates, one or more inverted polarity linkages, one or more abasic nucleoside linkages, one or more locked nucleic acids (LNAs), one or more 2′-O-methoxyethyl modified sugar moieties, one or more 2′-O-methyl modified sugar moieties, one or more 2′-O-(2-methoxyethyl) modified sugar moieties, one or more 2′-fluoro modified sugar moieties, one or more 2′-dimethylaminooxyethoxy modified sugar moieties, one or more 2′-dimethylaminoethoxyethoxy modified sugar moieties, one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, one or more cyclohexenyl nucleic acids (CeNAs), or any combination thereof. ### Claim 27 (depends on 26) The composition of claim 26, wherein the single molecule DNA-targeting RNA comprises said one or more 2′-O-methyl modified sugar moieties and/or said one or more 2′-fluoro modified sugar moieties. ### Claim 28 (depends on 1) The composition of claim 1, comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety. ### Claim 29 A composition comprising one or more nucleic acids, wherein said one or more nucleic acids encode: (a) a Cas9 protein that is a Streptococcus pyogenes Cas9; and (b) a single molecule DNA-targeting RNA comprising in 5′ to 3′ order: (i) a targeter-RNA comprising: (1) a first nucleotide sequence that hybridizes with a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and (ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA. ### Claim 30 (depends on 29) The composition of claim 29, wherein at least one of said one or more nucleic acids is a plasmid, a cosmid, a minicircle, a phage, or a viral vector. ### Claim 31 (depends on 29) The composition of claim 29, wherein at least one of said one or more nucleic acids is a vaccinia, polio, retro, lenti, adeno, adeno-associated, or herpes simplex viral vector. ### Claim 32 (depends on 29) The composition of claim 29, wherein the first and second nucleotide sequences are heterologous to one another. ### Claim 33 (depends on 29) The composition of claim 29, wherein said one or more nucleic acids comprises: a nucleotide sequence encoding said Cas9 protein, wherein the nucleotide sequence encoding said Cas9 protein is operably linked to a heterologous promoter; and/or a nucleotide sequence encoding said single molecule DNA-targeting RNA, wherein the nucleotide sequence encoding said single molecule DNA-targeting RNA is operably linked to a heterologous promoter. ### Claim 34 (depends on 29) The composition of claim 29, further comprising a nuclease inhibitor and/or a buffering agent. ### Claim 35 (depends on 29) The composition of claim 29, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain. ### Claim 36 (depends on 29) The composition of claim 29, wherein the Cas9 protein comprises a heterologous polypeptide. ### Claim 37 (depends on 29) The composition of claim 29, wherein the first nucleotide sequence comprises 18 to 25 nucleotides that hybridize with the target sequence. ### Claim 38 A composition comprising (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and (b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order: (i) a targeter-RNA comprising: (1) a first nucleotide sequence that hybridizes with a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and (ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUUUUU (SEQ ID NO: 432), and wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA. ### Claim 39 (depends on 38) The composition of claim 38, wherein the first nucleotide sequence comprises 18 to 25 nucleotides that hybridize with the target sequence. ### Claim 40 (depends on 38) The composition of claim 38, wherein the first and second nucleotide sequences are heterologous to one another. ### Claim 41 (depends on 38) The composition of claim 38, further comprising a nuclease inhibitor and/or a buffering agent. ### Claim 42 (depends on 38) The composition of claim 38, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain. ### Claim 43 (depends on 38) The composition of claim 38, wherein the Cas9 protein comprises a heterologous polypeptide. ### Claim 44 A composition comprising: (a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and (b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order: (i) a targeter-RNA comprising: (1) a first nucleotide sequence that hybridizes with a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and (ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA. ### Claim 45 (depends on 44) The composition of claim 44, wherein the first nucleotide sequence comprises 18 to 25 nucleotides that hybridize with the target sequence. ### Claim 46 (depends on 44) The composition of claim 44, wherein the first and second nucleotide sequences are heterologous to one another. ### Claim 47 (depends on 44) The composition of claim 44, wherein said intervening nucleotides are 3-5 nucleotides. ### Claim 48 (depends on 44) The composition of claim 44, wherein said intervening nucleotides are 5-10 nucleotides. ### Claim 49 (depends on 44) The composition of claim 44, wherein said intervening nucleotides are 10-20 nucleotides. ### Claim 50 (depends on 44) The composition of claim 44, wherein said intervening nucleotides are 20-40 nucleotides. ### Claim 51 (depends on 44) The composition of claim 44, said intervening nucleotides are 4 nucleotides. ### Claim 52 (depends on 44) The composition of claim 44, further comprising a nuclease inhibitor. ### Claim 53 (depends on 44) The composition of claim 44, wherein the composition is sterile. ### Claim 54 (depends on 44) The composition of claim 44, further comprising a reducing agent. ### Claim 55 (depends on 44) The composition of claim 44, wherein the composition comprises a salt. ### Claim 56 (depends on 44) The composition of claim 44, wherein the composition comprises one or more salts selected from: NaCl, MgCl2, KCl, and MgSO4. ### Claim 57 (depends on 44) The composition of claim 44, further comprising a donor polynucleotide. ### Claim 58 (depends on 44) The composition of claim 44, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain. ### Claim 59 (depends on 44) The composition of claim 44, wherein the Cas9 protein comprises a heterologous polypeptide. ### Claim 60 (depends on 44) The composition of claim 44, wherein the Cas9 protein is fused to a protein transduction domain (PTD). ### Claim 61 (depends on 44) The composition of claim 44, wherein a protein transduction domain (PTD) is covalently linked to the amino terminus (N-terminus) of the Cas9 protein. ### Claim 62 (depends on 44) The composition of claim 44, wherein a protein transduction domain (PTD) is covalently linked to the carboxyl terminus (C-terminus) of the Cas9 protein. ### Claim 63 (depends on 44) The composition of claim 44, wherein the composition comprises a protein-RNA complex comprising the Cas9 protein and the single molecule DNA-targeting RNA. ### Claim 64 (depends on 44) The composition of claim 44, comprising the single molecule DNA-targeting RNA and the nucleic acid encoding the Cas9 protein. ### Claim 65 (depends on 44) The composition of claim 44, comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more non-natural internucleoside linkages, one or more nucleic acid mimetics, one or more modified sugar moieties, one or more modified nucleobases, or any combination thereof. ### Claim 66 (depends on 65) The composition of claim 65, wherein the single molecule DNA-targeting RNA comprises said one or more non-natural internucleoside linkages and/or said one or more modified sugar moieties. ### Claim 67 (depends on 44) The composition of claim 44, comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more phosphorothioates, one or more inverted polarity linkages, one or more abasic nucleoside linkages, one or more locked nucleic acids (LNAs), one or more 2′-O-methoxyethyl modified sugar moieties, one or more 2′-O-methyl modified sugar moieties, one or more 2′-O-(2-methoxyethyl) modified sugar moieties, one or more 2′-fluoro modified sugar moieties, one or more 2′-dimethylaminooxyethoxy modified sugar moieties, one or more 2′-dimethylaminoethoxyethoxy modified sugar moieties, one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, one or more cyclohexenyl nucleic acids (CeNAs), or any combination thereof. ### Claim 68 (depends on 67) The composition of claim 67, wherein the single molecule DNA-targeting RNA comprises said one or more 2′-O-methyl modified sugar moieties and/or said one or more 2′-fluoro modified sugar moieties. ### Claim 69 (depends on 44) The composition of claim 44, comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety. ### Claim 70 A composition comprising one or more nucleic acids, wherein said one or more nucleic acids encode: (a) a Cas9 protein that is a Streptococcus pyogenes Cas9; and (b) a single molecule DNA-targeting RNA comprising in 5′ to 3′ order: (i) a targeter-RNA comprising: (1) a first nucleotide sequence that hybridizes with a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and (ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs, wherein (i) and (ii) are covalently linked by intervening nucleotides, wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA. ### Claim 71 (depends on 70) The composition of claim 70, wherein the first and second nucleotide sequences are heterologous to one another. ### Claim 72 (depends on 70) The composition of claim 70, wherein said one or more nucleic acids comprises: a nucleotide sequence encoding said Cas9 protein, wherein the nucleotide sequence encoding said Cas9 protein is operably linked to a heterologous promoter; and/or a nucleotide sequence encoding said single molecule DNA-targeting RNA, wherein the nucleotide sequence encoding said single molecule DNA-targeting RNA is operably linked to a heterologous promoter. ### Claim 73 (depends on 70) The composition of claim 70, further comprising a nuclease inhibitor and/or a buffering agent. ### Claim 74 (depends on 70) The composition of claim 70, wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain. ### Claim 75 (depends on 70) The composition of claim 70, wherein the Cas9 protein comprises a heterologous polypeptide. ### Claim 76 (depends on 70) The composition of claim 70, wherein the first nucleotide sequence comprises 18 to 25 nucleotides that hybridize with the target sequence. ### Claim 77 (depends on 70) The composition of claim 70, wherein at least one of said one or more nucleic acids is a plasmid, a cosmid, a minicircle, a phage, or a viral vector. ### Claim 78 (depends on 77) The composition of claim 77, wherein at least one of said one or more nucleic acids is a vaccinia, polio, retro, lenti, adeno, adeno-associated, or herpes simplex viral vector.