# US 12,006,500 B2 · Composition and methods of RNAi prophylactics and therapeutics for treatment of severe acute respiratory infection caused by 2019 novel coronavirus (2019-nCoV)

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 12,006,500 B2
- Document ID: US12006500B2
- Status: Granted
- Kind: B2
- Application number: 17/157,920
- Filed: 2021-01-25
- Published: 2021-08-12
- Granted: 2024-06-11
- Earliest claimed: 2020-01-23
- Assignees: Sirnaomics, Inc.
- Applicants: Sirnaomics, Inc.
- Inventors: Danny Tang; Xueping Chen; Patrick Y. Lu; Vera Simonenko; David Evans; John Xu; Deling Wang; Alan Lu
- Web page: https://patentgrep.com/patent/US12006500B2

## CPC

- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- A61K 9/007: {Pulmonary tract; Aromatherapy}
- A61K 9/513: {Organic macromolecular compounds; Dendrimers}
- A61K 31/713: Double-stranded nucleic acids or oligonucleotides
- A61K 47/28: Steroids, e.g. cholesterol, bile acids or glycyrrhetinic acid
- A61K 47/543: {Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine}
- A61K 47/6455: {Polycationic oligopeptides, polypeptides or polyamino acids, e.g. for complexing nucleic acids}
- A61K 47/6911: {the form being a liposome}
- A61K 47/6931: {the material constituting the nanoparticle being a polymer}
- A61P 31/14: for RNA viruses
- C12N 15/1131: {against viruses}
- A61K 9/51: Nanocapsules; {Nanoparticles; (nanotubes A61K9/0092; polymeric micelles A61K9/1075; polymersomes A61K9/1273; pure drug nanoparticles A61K9/14; drug nanoparticles with adsorbed surface modifiers A61K9/141; conjugates, e.g. between drug and non-active nanoparticles, A61K47/50; preparations for in vivo diagnosis A61K49/00; with radioactive substances A61K51/00)}
- C12N 2310/14: interfering nucleic acids [NA]
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS

## Abstract

Compositions and methods for development of potent siRNA therapeutics for prevention and treatment of Corona Virus (2019-nCoV; COVID-19) infections are provided. The compositions include a pharmaceutical composition comprising siRNA cocktails that target critical viral genes and pharmaceutically acceptable polymeric nanoparticle carriers and liposomal nanoparticle carriers. Administration methods for prevention and treatment are provided, including airway instillation, subcutaneous injections and nebulizer aerosolization.

## Claims

### Claim 1

A pharmaceutical composition comprising at least a first siRNA molecule that targets a conserved region of an ORF1AB gene of the Wuhan seafood market novel pneumonia 2019 Novel Coronavirus (2019-nCoV) genome, and at least a second siRNA that targets a conserved region of an N-protein gene of said 2019-nCoV genome, wherein said composition comprises a pharmaceutically acceptable carrier, wherein said carrier comprises a polymeric nanoparticle and/or a liposomal nanoparticle carrier, wherein said first siRNA molecule is selected from the group consisting of SEQ ID NO:401-403 and 414-418, and wherein said second siRNA molecule is selected from the group consisting of SEQ ID NO: 404-406 and 425-431.

### Claim 2 (depends on 1)

The composition of claim 1 wherein the siRNA molecules inhibit non-structural (NS) RdRp, replicase or helicase virus gene expression.

### Claim 3 (depends on 1)

The composition of claim 1, wherein the siRNA molecules comprises oligonucleotides having a length of 19-25 base pairs.

### Claim 4 (depends on 1)

The composition of claim 1, wherein the siRNAs molecules are designed against the sense strand sequences of NS genes.

### Claim 5 (depends on 1)

The composition according to claim 1, wherein the polymeric nanoparticle carrier comprises a Histidine-Lysine co-polymer (HKP).

### Claim 6 (depends on 5)

The composition of claim 5, wherein said HKP and said siRNA molecules self-assemble into nanoparticles.

### Claim 7 (depends on 5)

The composition of claim 5, wherein said SLiC and said siRNA molecules self-assemble into nanoparticles in a formulation comprising cholesterol.

### Claim 8 (depends on 1)

The composition according to claim 1, wherein the liposomal nanoparticle carrier comprises a Spermine-Lipid Conjugates (SLiC) in formulation with cholesterol.

### Claim 9

A pharmaceutical composition comprising at least a first siRNA molecule that targets a conserved region of an ORF1AB gene of the Wuhan seafood market novel pneumonia 2019 Novel Coronavirus (2019-nCoV) genome, and at least a second siRNA that targets a conserved region of an N-protein gene of said 2019-nCoV genome, wherein said composition comprises a pharmaceutically acceptable carrier, wherein said carrier comprises a polymeric nanoparticle and/or a liposomal nanoparticle carrier, wherein the composition further comprises a combination of two sense strands, one from each of said first and second siRNA molecules, and said combination is selected from the group consisting of:
CoV3 and CoV18
CoV3 and CoV14
CoV4 and CoV14 and
CoV4 and CoV18,
respectfully, wherein CoV3 has the sequence GGAAGGAAGTTCTGTTGAA (SEQ ID NO: 401) or GGAAGGAAGTTCTGTTGAATTAAAA (SEQ ID NO: 402), CoV4 comprises the sequence GCCATTAGTGCAAAGAATA (SEQ ID NO: 403), CoV-14 has the sequence GGCCGCAAATTGCACAATT (SEQ ID NO: 404), and CoV18 has the sequence CCACCAACAGAGCCTAAAA (SEQ ID NO: 405) or CCACCAACAGAGCCTAAAAAGGACA (SEQ ID NO: 406).

### Claim 10 (depends on 9)

The composition of claim 9, wherein the combination of sense strands comprises CoV3 and CoV18, and wherein the CoV3 sense strand has the sequence GGAAGGAAGTTCTGTTGAA (SEQ ID NO: 401) and the CoV18 sense strand has the sequence CCACCAACAGAGCCTAAAA (SEQ ID NO: 405).

### Claim 11 (depends on 9)

The composition of claim 9, wherein the combination of sense strands comprises CoV3 and CoV18, and wherein the CoV3 sense strand has the sequence GGAAGGAAGTTCTGTTGAA (SEQ ID NO: 401) and the CoV18 sense strand has the sequence CCACCAACAGAGCCTAAAAAGGACA (SEQ ID NO: 406).

### Claim 12 (depends on 9)

The composition of claim 9, wherein the combination of sense strands comprises CoV3 and CoV18, and wherein the CoV3 sense strand has the sequence GGAAGGAAGTTCTGTTGAATTAAAA (SEQ ID NO: 402) and the CoV18 sense strand has the sequence CCACCAACAGAGCCTAAAA (SEQ ID NO: 405).

### Claim 13 (depends on 9)

The composition of claim 9, wherein the combination of sense strands comprises CoV3 and CoV14, and wherein the CoV3 sense strand has the sequence GGAAGGAAGTTCTGTTGAATTAAAA (SEQ ID NO: 402) and the CoV18 sense strand has the sequence CCACCAACAGAGCCTAAAAAGGACA (SEQ ID NO: 406).

### Claim 14 (depends on 9)

The composition of claim 9, wherein the combination of sense strands comprises CoV4 and CoV14, and wherein the CoV4 sense strand has the sequence GCCATTAGTGCAAAGAATA (SEQ ID NO: 403), and the CoV14 sense strand has the sequence GGCCGCAAATTGCACAATT (SEQ ID NO: 404).

### Claim 15 (depends on 9)

The composition of claim 9, wherein the combination of sense strands comprises CoV4 and CoV18, and wherein the CoV4 sense strand has the sequence GCCATTAGTGCAAAGAATA (SEQ ID NO: 403), and the CoV18 sense strand has the sequence CCACCAACAGAGCCTAAAA (SEQ ID NO: 405).

### Claim 16 (depends on 9)

The composition of claim 9, wherein the combination of sense strands comprises CoV4 and CoV18 and wherein the CoV4 sense strand has the sequence GCCATTAGTGCAAAGAATA (SEQ ID NO: 403), and the CoV18 sense strand has the sequence CCACCAACAGAGCCTAAAAAGGACA (SEQ ID NO: 406).