# US 12,005,124 B2 · Muscle targeting complexes and uses thereof for treating dystrophinopathies > Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt - Number: US 12,005,124 B2 - Document ID: US12005124B2 - Status: Granted - Kind: B2 - Application number: 18/492,894 - Filed: 2023-10-24 - Published: 2024-02-29 - Granted: 2024-06-11 - Earliest claimed: 2018-08-02 - Assignees: Dyne Therapeutics, Inc. - Applicants: Dyne Therapeutics, Inc. - Inventors: Romesh R. Subramanian; Mohammed T. Qatanani; Timothy Weeden - Web page: https://patentgrep.com/patent/US12005124B2 ## CPC - A61K 47/6807: {the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense} - A61K 31/713: Double-stranded nucleic acids or oligonucleotides - A61K 47/10: Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers - A61K 47/549: {Sugars, nucleosides, nucleotides or nucleic acids} - A61K 47/6849: {the antibody targeting a receptor, a cell surface antigen or a cell surface determinant} - A61P 9/00: Drugs for disorders of the cardiovascular system - A61P 21/00: Drugs for disorders of the muscular or neuromuscular system - C07K 16/2881: {against CD71} - C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} - C12N 15/1137: {against enzymes (viral enzymes C12N15/1131; receptors C12N15/1138)} - C12Y 204/02008: Hypoxanthine phosphoribosyltransferase (2.4.2.8) - A61K 2039/505: {comprising antibodies} - C07K 2317/24: containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered - C07K 2317/33: Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity - C07K 2317/55: Fab or Fab' - C07K 2317/77: Internalization into the cell - C07K 2317/92: Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value - C12N 2310/11: Antisense - C12N 2310/14: interfering nucleic acids [NA] - C12N 2310/315: Phosphorothioates - C12N 2310/322: 2'-R Modification - C12N 2310/3233: Morpholino-type ring - C12N 2310/345: having at least two different backbone modifications - C12N 2310/346: having a combination of backbone and sugar modifications - C12N 2310/3513: Protein; Peptide - C12N 2320/32: Special delivery means, e.g. tissue-specific - C12N 2320/33: Alteration of splicing - A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D) - A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS - C07K: PEPTIDES (peptides in foodstuffs A23; obtaining protein compositions for foodstuffs, working-up proteins for foodstuffs A23J; preparations for medicinal purposes A61K; peptides containing beta-lactam rings C07D; cyclic dipeptides not having in their molecule any other peptide link than those which form their ring, e.g. piperazine-2,5-diones, C07D; ergot alkaloids of the cyclic peptide type C07D519/02; macromolecular compounds having statistically distributed amino acid units in their molecules, i.e. when the preparation does not provide for a specific; but for a random sequence of the amino acid units, homopolyamides and block copolyamides derived from amino acids C08G69/00; macromolecular products derived from proteins C08H1/00; preparation of glue or gelatine C09H; single cell proteins, enzymes C12N; genetic engineering processes for obtaining peptides C12N15/00; compositions for measuring or testing processes involving enzymes C12Q; investigation or analysis of biological material G01N33/00) - C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00) - C12Y: ENZYMES ## Abstract Aspects of the disclosure relate to complexes comprising a muscle-targeting agent covalently linked to a molecular payload. In some embodiments, the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. In some embodiments, the molecular payload promotes the expression or activity of a functional dystrophin protein. In some embodiments, the molecular payload is an oligonucleotide, such as an antisense oligonucleotide, e.g., an oligonucleotide that causes exon skipping in a mRNA expressed from a mutant DMD allele. ## Claims ### Claim 1 A complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide, wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1; wherein the oligonucleotide of the complex is 30 nucleotides in length and comprises a region of complementarity of 25, 26, 27, 28, 29, or 30 nucleotides in length, wherein the region of complementarity is complementary to the annealing site of an oligonucleotide consisting of the sequence of SEQ ID NO: 195, wherein the oligonucleotide of the complex is a phosphorodiamidate morpholino oligomer (PMO); and wherein the oligonucleotide of the complex is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence. ### Claim 2 (depends on 1) The complex of claim 1, wherein the anti-transferrin receptor antibody is in the form of a Fab fragment. ### Claim 3 (depends on 2) The complex of claim 2, wherein the region of complementarity is 30 nucleotides in length. ### Claim 4 (depends on 3) The complex of claim 3, wherein the oligonucleotide of the complex comprises 28, 29, or 30 contiguous nucleotides of the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296). ### Claim 5 (depends on 4) The complex of claim 4, wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody, wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide of the complex, and the alkyne is provided in a bicyclononyne moiety. ### Claim 6 (depends on 5) The complex of claim 5, wherein the anti-transferrin receptor antibody is not glycosylated. ### Claim 7 (depends on 1) The complex of claim 1, wherein the nucleobases of the region of complementarity are selected from adenosine, thymidine, guanosine, and cytosine. ### Claim 8 (depends on 1) A composition comprising the complex of claim 1 and a pharmaceutically acceptable carrier, wherein the composition is formulated for intravenous administration. ### Claim 9 A complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide, wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1; wherein the oligonucleotide is 30 nucleotides in length, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296); and wherein the oligonucleotide is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence. ### Claim 10 (depends on 9) The complex of claim 9, wherein the anti-transferrin receptor antibody is in the form of a Fab fragment. ### Claim 11 (depends on 10) The complex of claim 10, wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody, wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide and the alkyne is provided in a bicyclononyne moiety. ### Claim 12 (depends on 11) The complex of claim 11, wherein the anti-transferrin receptor antibody is not glycosylated. ### Claim 13 (depends on 9) A composition comprising the complex of claim 9 and a pharmaceutically acceptable carrier, wherein the composition is formulated for intravenous administration. ### Claim 14 (depends on 1) A method of inducing skipping of exon 51 of a DMD pre-mRNA in a muscle cell of a subject, the method comprising administering to the subject the complex of claim 1. ### Claim 15 A method of treating Duchenne muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide, wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1; wherein the oligonucleotide of the complex is 30 nucleotides in length and comprises a region of complementarity of 25, 26, 27, 28, 29, or 30 nucleotides in length, wherein the region of complementarity is complementary to the annealing site of an oligonucleotide consisting of the sequence of SEQ ID NO: 195, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO); and wherein the oligonucleotide of the complex is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence. ### Claim 16 (depends on 15) The method of claim 15, wherein the oligonucleotide of the complex comprises the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296), and wherein the anti-transferrin receptor antibody is in the form of a Fab fragment. ### Claim 17 (depends on 16) The method of claim 16, wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody, wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide of the complex, and the alkyne is provided in a bicyclononyne moiety. ### Claim 18 (depends on 15) The method of claim 15, wherein the oligonucleotide of the complex promotes the expression or activity of a functional dystrophin protein in a muscle cell of the subject. ### Claim 19 (depends on 18) The method of claim 18, wherein the muscle cell is a skeletal muscle cell or a cardiac muscle cell. ### Claim 20 (depends on 15) The method of claim 15, wherein the nucleobases of the region of complementarity are selected from adenosine, thymidine, guanosine, and cytosine. ### Claim 21 (depends on 15) The method of claim 15, wherein the subject is human. ### Claim 22 (depends on 15) The method of claim 15, wherein the complex is administered to the subject intravenously. ### Claim 23 (depends on 9) A method of inducing skipping of exon 51 of a DMD pre-mRNA in a muscle cell of a subject, the method comprising administering to the subject the complex of claim 9. ### Claim 24 A method of treating Duchenne muscular dystrophy in a subject in need thereof, the method comprising administering to the subject a complex comprising an anti-transferrin receptor antibody covalently linked to an exon-skipping oligonucleotide, wherein the anti-transferrin receptor antibody comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region comprise human or humanized framework regions; wherein the anti-transferrin receptor antibody binds in the range of C89 to F760 of human transferrin receptor protein 1 (TfR1) having an amino acid sequence as set forth in SEQ ID NO: 1; wherein the oligonucleotide is 30 nucleotides in length, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising the sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 296); and wherein the oligonucleotide is covalently linked at the 5′ end to a lysine residue of the anti-transferrin receptor antibody via a cleavable linker comprising a valine-citrulline sequence. ### Claim 25 (depends on 24) The method of claim 24, wherein the cleavable linker comprises a triazole covalently linked to the valine-citrulline sequence and further covalently linked to a lysine residue of the anti-transferrin receptor antibody, wherein the triazole is obtained by a cycloaddition reaction between an azide and an alkyne to form the triazole, and wherein prior to the cycloaddition reaction, the azide is covalently linked to the valine-citrulline sequence of the cleavable linker that is covalently linked to the 5′ end of the oligonucleotide and the alkyne is provided in a bicyclononyne moiety. ### Claim 26 (depends on 25) The method of claim 25, wherein the anti-transferrin receptor antibody is not glycosylated. ### Claim 27 (depends on 24) The method of claim 24, wherein the oligonucleotide promotes the expression or activity of a functional dystrophin protein in a muscle cell of the subject. ### Claim 28 (depends on 27) The method of claim 27, wherein the muscle cell is a skeletal muscle cell or a cardiac muscle cell. ### Claim 29 (depends on 24) The method of claim 24, wherein the subject is human. ### Claim 30 (depends on 24) The method of claim 24, wherein the complex is administered to the subject intravenously.