# US 11,970,707 B2 · Strong insulator and uses thereof in gene delivery

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 11,970,707 B2
- Document ID: US11970707B2
- Status: Granted
- Kind: B2
- Application number: 16/648,118
- Filed: 2018-09-18
- Published: 2020-08-13
- Granted: 2024-04-30
- Earliest claimed: 2017-09-18
- Assignees: Children's Hospital Medical Center
- Applicants: Children's Hospital Medical Center
- Inventors: Punam Malik
- Web page: https://patentgrep.com/patent/US11970707B2

## CPC

- C12N 15/86: Viral vectors
- C12N 7/00: Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof (preparing medicinal viral antigen or antibody compositions, e.g. virus vaccines, A61K39/00)
- C12N 9/226: {Class 2 CAS enzyme complex, e.g. single CAS protein}
- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- C12N 15/907: {in mammalian cells}
- C12N 2310/20: involving clustered regularly interspaced short palindromic repeats [CRISPR]
- C12N 2740/10043: viral genome or elements thereof as genetic vector
- C12N 2740/13021: Viruses as such, e.g. new isolates, mutants or their genomic sequences
- C12N 2740/13043: viral genome or elements thereof as genetic vector
- C12N 2740/15043: viral genome or elements thereof as genetic vector
- C12N 2740/16043: viral genome or elements thereof as genetic vector
- C12N 2800/80: Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
- C12N 2830/40: being an insulator
- C12N 2830/48: regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
- C12N 2830/60: from viruses
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)

## Abstract

A strong insulator fragment from foamy virus, which can be used to insulate expression of a transgene and reduce genotoxicity of integrating vectors comprising such. The insulator fragment can also be used in gene targeting constructs in gene editing.

## Claims

### Claim 1

A nucleic acid construct for gene delivery, the nucleic acid construct comprising at least one gene of interest (GOI) flanked by an insulator fragment, said insulator fragment consisting essentially of a nucleotide sequence having at least 90% sequence identity to AAGGGAGACATCTAGTGATATAAGTGTGAACT ACAC (SEQ ID NO:2) or at least 90% sequence identity to GTGTAGTTCACACTTATATCACTAGATGTCTCCCTT (SEQ ID NO: 1), said insulator fragment being heterologous to at least one fragment of said nucleic acid.

### Claim 2 (depends on 1)

The nucleic acid construct of claim 1, wherein the insulator fragment comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO: 1.

### Claim 3 (depends on 1)

The nucleic acid construct of claim 1, wherein the insulator fragment comprises multiple copies of SEQ ID NO:2 or SEQ ID NO: 1.

### Claim 4 (depends on 1)

The nucleic acid construct of claim 1, wherein the GOI encodes an agent of interest, which is a protein or a nucleic acid.

### Claim 5 (depends on 4)

The nucleic acid construct of claim 4, wherein to GOI encodes a therapeutic protein, which is an antibody, a growth factor, a cytokine, a coagulation factor, an enyzme, or a hemoglobin; or wherein the GOI is a nuleic acid, which is an interfering RNA, an anti-sense eligonucleotide, or microRNA.

### Claim 6 (depends on 1)

The nucleic acid construct of claim 1, wherein the insulator fragment is located upstream to the GOI or downstream to the GOI.

### Claim 7 (depends on 1)

The nucleic acid construct of claim 1, wherein the nucleic acid construct comprises at least two copies of the insulator fragment, one being upstream to the GOI, and the other one being downstream to the GOI.

### Claim 8 (depends on 1)

The nucleic acid construct of claim 1, wherein the nucleic acid construct comprises two GOIs, and at least one insulator fragment is located between the two GOIs.

### Claim 9 (depends on 1)

The nucleic acid construct of claim 1, wherein the nucleic acid construct is a vector.

### Claim 10 (depends on 9)

The nucleic acid construct of claim 9, wherein the vector is a viral vector.

### Claim 11 (depends on 10)

The nucleic acid construct of claim 10, wherein the viral vector is a retroviral vector, an adenoviral vector, or an adeno-associated viral vector.

### Claim 12 (depends on 11)

The nucleic acid construct of claim 11, wherein the vector is a retroviral vector, which comprises a 5′ long terminal repeat (LTR) and a 3′LTR, wherein the insulator fragment is located inside the 5′ LTR, inside the 3′LTR, or inside both the 5′ LTR and 3′ LTR, and wherein the insulator is heterologous to the 5′ LTR and/or the 3′LTR.

### Claim 13 (depends on 12)

The nucleic acid construct of claim 12, wherein the nucleic acid construct comprises multiple copies of the insulator fragment, at least one of which is located inside either the 5′ LTR or the 3′ LTR and at least one of which is located adjacent to the GOI, either upstream or downstream.

### Claim 14 (depends on 11)

The nucleic acid construct of claim 11, wherein the viral vector is a retroviral vector, which is a lentivirus vector or a gammaretrovirus vector.

### Claim 15 (depends on 12)

The nucleic acid construct of claim 12, wherein the 3′LTR comprises a polyadenylation (polyA) enhancer signal sequence.

### Claim 16 (depends on 15)

The nucleic acid construct of claim 15, wherein the upstream polyadenylation (polyA) enhancer signal sequence is an upstream sequence element (USE) derived from an SV40 late polyA signal sequence; or wherein the upstream polyA enhancer signal sequence replaces a U3 region in the 3′ LTR.

### Claim 17 (depends on 11)

The nucleic acid construct of claim 11, which further comprises one or more of the following elements:
a psi (w) packaging signal;
a rev response element (RRE);
a gag element;
an env splice acceptor sequence;
one or more copies of a heterologous polyA signal sequence downstream from a 3′ LTR;
one or more chromatin insulator elements;
a central polypurine tract (cPPT); and
a post-transcriptional regulatory element (PRE).

### Claim 18 (depends on 11)

The nucleic acid construct of claim 11, which is a self-inactivating (SIN) retroviral vector.

### Claim 19 (depends on 1)

The nucleic acid construct of claim 1, wherein the nucleic acid construct is a gene target construct for use in gene editing.

### Claim 20 (depends on 1)

A method for delivering an agent of interest to host cells, the method comprising contacting host cells with an effective amount of a nucleic acid construct of claim 1.

### Claim 21 (depends on 11)

A method for delivering an agent of interest to a subject, the method comprising administering to a subject in need thereof a viral particle comprising a genetic material produced from a retroviral vector set forth in claim 11.

### Claim 22 (depends on 19)

A method for integrating an exogenous gene into the genome of host cells, the method comprising (i) delivering a DNA endonuclease and a gene targeting construct set forth in claim 19 into host cells, and (11) incubating the host cells under conditions allowing for cleavage at a site of a chromosome of the host cells and integration of the gene targeting construct into the chromosome.

### Claim 23

A nucleic acid consisting essentially of a nucleotide sequence at least 90% identical to SEQ ID NO:2 or at least 90% identical to GTGTAGTTCACACTTATATCACTAGATGTCTCCCTT (SEQ ID NO: 1), wherein the nucleic acid is an insulator, said insulator being heterologous to at least one fragment of said nucleic acid.

### Claim 24 (depends on 23)

The nucleic acid of claim 23, wherein the nucleic acid comprises the nucleotide sequence of SEQ ID NO:2 or SEQ ID NO: 1.