Nicking and extension amplification reaction (NEAR) of respiratory syncytial virus species
AssigneeIonian Technologies, Inc.
InventorsHonghua Zhang, Richard Roth
Life of this patent
Estimating the term…
Abstract
This invention relates to methods and compositions for detecting the presence or absence of a Respiratory Syncytial Virus target nucleic acid in a biological sample using isothermal nucleic acid amplification.
Claims17
A composition comprising a forward template comprising a nucleic acid sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of a Respiratory Syncytial Virus (RSV) nonstructural NS2 gene antisense strand;
- a nicking enzyme binding site and a nicking site upstream of the recognition region;
- and a stabilizing region upstream of the nicking site, wherein the nucleic acid sequence of the forward template comprises a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO:
- 1 (CGACTCACACGAGTCGAAAACTTGATGAAAGA);
- and
- a reverse template comprising a nucleic acid sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of a RSV nonstructural NS2 gene sense strand;
- a nicking enzyme binding site and a nicking site upstream of the recognition region;
- and a stabilizing region upstream of the nicking site, wherein the nucleic acid sequence of the reverse template comprises a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO:
- 2 (AGACTCCACACGGAGTCTAGTTGACCAGGAATG).
A kit comprising:
- a pair of template oligonucleotides selected from the group consisting of:
- (a) a first pair of template oligonucleotides comprising a first forward template comprising a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO:
- 1;
- and
- a first reverse template comprising a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO 2;
- and
- (b) a second pair of template oligonucleotides comprising a second forward template comprising a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO:
- 6;
- and
- a second reverse template comprising a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO:
- 7.
A composition comprising a forward template comprising a nucleic acid sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of a RSV nucleocapsid gene N antisense strand;
- a nicking enzyme binding site and a nicking site upstream of the recognition region;
- and a stabilizing region upstream of the nicking site, wherein the nucleic acid sequence of the forward template comprises a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO:
- 6 (GACTCGCACACGAGTCACGTAGTACAGGAGATAA);
- and
- a reverse template comprising a nucleic acid sequence comprising a recognition region at the 3′ end that is complementary to the 3′ end of a RSV nucleocapsid gene N sense strand;
- a nicking enzyme binding site and a nicking site upstream of the recognition region;
- and a stabilizing region upstream of the nicking site, wherein the nucleic acid sequence of the reverse template comprises a nucleotide sequence having at least 80%, at least 85%, or at least 95% sequence identity to SEQ ID NO 7:
- (GACTCCACACGGAGTCGCTTTTGCACATCATAA).
Dependencies are inferred from the claim text.