Method of producing regulatory T cells by culturing regulatory T cells obtained from umbilical cord blood
AssigneeTeraimmune, Inc.
InventorsYong Chan Kim, Nari Byun, Jeong Heon Yoon
Life of this patent
Estimating the term…
Abstract
The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.
Claims5
A method for producing a population of regulatory T cells comprising:
- culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide of SEQ ID NO. 1 to expand the initial population of regulatory T cells.
Dependencies are inferred from the claim text.