# US 11,555,223 B2 · Methods for detecting Norovirus

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 11,555,223 B2
- Document ID: US11555223B2
- Status: Granted
- Kind: B2
- Application number: 17/063,078
- Filed: 2020-10-05
- Published: 2021-04-01
- Granted: 2023-01-17
- Earliest claimed: 2016-06-03
- Assignees: Quest Diagnostics Investments Incorporated
- Applicants: Quest Diagnostics Investments LLC
- Inventors: Peter Lee; Raymond Huang; Kristin Ramos; Jules Chen; Michelle Tabb
- Web page: https://patentgrep.com/patent/US11555223B2

## CPC

- C12Q 1/701: {Specific hybridization probes}
- A61P 31/14: for RNA viruses
- C12N 7/00: Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof (preparing medicinal viral antigen or antibody compositions, e.g. virus vaccines, A61K39/00)
- C12Q 1/68: involving nucleic acids
- C12Q 1/686: Polymerase chain reaction [PCR]
- C12Q 1/70: involving virus or bacteriophage {(immunoassay for viruses G01N33/56983)}
- G01N 33/56983: {Viruses}
- A61K 39/00: Medicinal preparations containing antigens or antibodies (materials for immunoassay G01N33/53)
- C12N 2770/16021: Viruses as such, e.g. new isolates, mutants or their genomic sequences
- C12Q 2600/106: Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
- C12Q 2600/112: Disease subtyping, staging or classification
- G01N 2333/08: RNA viruses
- C12Q: MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS (immunoassay G01N33/53); COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- G01N: INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES (measuring or testing apparatus or processes other than immunoassay, involving enzymes or microorganisms C12M, C12Q)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)

## Abstract

The present disclosure provides methods and compositions for determining whether a patient exhibiting acute gastroenteritis will benefit from treatment with therapeutic agents that inhibit Norovirus genogroup I (GI) or Norovirus genogroup II (GII). The methods disclosed herein are based on detecting Norovirus genogroup I (GI) and Norovirus genogroup II (GII) in a stool sample without extracting viral nucleic acids from a clinical specimen prior to performing real-time reverse transcription PCR. Kits for use in practicing the methods are also provided.

## Claims

### Claim 1

A method for detecting the presence of Norovirus genogroup I (GI) in a stool sample comprising: contacting the stool sample with a primer pair that amplifies a Norovirus genogroup I (GI) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 2 or a complement thereof, to produce a reaction-sample mixture under conditions where real-time RT-PCR amplification of the Norovirus genogroup I (GI) target nucleic acid, if present in the stool sample, occurs without extraction of target nucleic acids from the stool sample.

### Claim 2 (depends on 1)

The method of claim 1, further comprising:
(a) subjecting the reaction-sample mixture to real-time RT-PCR conditions under which the Norovirus genogroup I (GI) target nucleic acid present in the stool sample is amplified to produce a fluorescent signal;
(b) detecting the fluorescent signal generated by each amplified Norovirus genogroup I (GI) target nucleic acid produced in step (a); and
(c) detecting the presence of Norovirus genogroup I (GI) in the stool sample by evaluating the fluorescent signal of each amplified Norovirus genogroup I (GI) target nucleic acid;
wherein the stool sample is not subjected to an extraction or purification step prior to amplification.

### Claim 3 (depends on 1)

The method of claim 1, wherein the primer pair consists of a forward primer comprising 5′d CGYTGGATGCGITTYCATGA 3′(SEQ ID NO: 5) and a reverse primer comprising 5′d TCCTTAGACGCCATCATCATTTAC 3′ (SEQ ID NO: 6).

### Claim 4 (depends on 1)

The method of claim 1, wherein Norovirus genogroup I (GI) comprises one or more genotypes selected from the group consisting of GI.1, GI.2, GI.3, GI.4, GI.5, GI.6, GI.7, GI.8, GI.9, GI.10 and GI.14.

### Claim 5 (depends on 1)

The method of claim 1, further comprising contacting the stool sample with a first nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup I (GI) target nucleic acid sequence of SEQ ID NO: 2 or a complement thereof, wherein the first nucleic acid probe is detectably labeled and comprises 5′d TGGACAGGAGAYCGCIATCTCYTGCCCGA 3′ (SEQ ID NO: 7) or a complement thereof.

### Claim 6 (depends on 5)

The method of claim 5, wherein the first nucleic acid probe is detectably labelled with CFR610 fluorophore.

### Claim 7 (depends on 1)

The method of claim 1, further comprising contacting the stool sample with a second nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup I (GI) target nucleic acid sequence of SEQ ID NO: 2 or a complement thereof, wherein the second nucleic acid probe is detectably labeled and comprises 5′d TGGACAGGAGATCGCAATCTACTGCCTGA 3′(SEQ ID NO: 8) or a complement thereof.

### Claim 8 (depends on 7)

The method of claim 7, wherein the second nucleic acid probe is detectably labelled with CFR610 fluorophore.

### Claim 9

A method for detecting the presence of Norovirus genogroup II (GII) in a stool sample comprising: contacting the stool sample with a primer pair that amplifies a Norovirus genogroup II (GII) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 4 or a complement thereof, to produce a reaction-sample mixture under conditions where real-time RT-PCR amplification of the Norovirus genogroup II (GII) target nucleic acids, if present in the stool sample, occurs without extraction of target nucleic acids from the stool sample.

### Claim 10 (depends on 9)

The method of claim 9, further comprising:
(a) subjecting the reaction-sample mixture to real-time RT-PCR conditions under which the Norovirus genogroup II (GII) target nucleic acid present in the stool sample is amplified to produce a fluorescent signal;
(b) detecting the fluorescent signal generated by each amplified Norovirus genogroup II (GII) target nucleic acid produced in step (a); and
(c) detecting the presence of Norovirus genogroup II (GII) in the stool sample by evaluating the fluorescent signal of each amplified Norovirus genogroup II (GII) target nucleic acid;
wherein the stool sample is not subjected to an extraction or purification step prior to amplification.

### Claim 11

A method for selecting a patient suffering from acute gastroenteritis for treatment with a therapeutic agent that inhibits Norovirus genogroup II (GII) comprising:
contacting a stool sample obtained from the patient with: contacting the stool sample with a primer pair that amplifies a Norovirus genogroup II (GII) target nucleic acid comprising nucleotides that are at least 80-95% identical to SEQ ID NO: 4 or a complement thereof, to produce a reaction-sample mixture under conditions where real-time RT-PCR amplification of the Norovirus genogroup II (GII) target nucleic acids, if present in the stool sample, occurs without extraction of target nucleic acids from the stool sample.

### Claim 12 (depends on 11)

The method of claim 11, further comprising:
(a) subjecting the reaction-sample mixture to real-time RT-PCR conditions under which the Norovirus genogroup II (GII) target nucleic acid present in the stool sample is amplified to produce a fluorescent signal;
(b) detecting the fluorescent signal generated by each amplified Norovirus genogroup II (GII) target nucleic acid produced in step (a); and
(c) selecting the patient for treatment with a therapeutic agent that inhibits Norovirus genogroup II (GII), if a fluorescent signal for the Norovirus genogroup II (GII) target nucleic acid is detected;
wherein the stool sample is not subjected to an extraction or purification step prior to amplification.

### Claim 13 (depends on 9, 11)

The method of claim 9 or 11, wherein the primer pair consists of a forward primer comprising 5′d TGTTYAGGTGGATGAGRTTCTCIGA 3′ (SEQ ID NO: 9) and a reverse primer comprising 5′d TCGACGCCATCTTCATTCACA 3′ (SEQ ID NO: 10).

### Claim 14 (depends on 9, 11)

The method of claim 9 or 11, wherein Norovirus genogroup II (GII) comprises one or more genotypes selected from the group consisting of GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.8, GII.9, GII.10, GII.11,GII.12, GII.13, GII.14, GII.15, GII.16, GII.17, GII.18, GII.19, GII.20, GII.21, GII.22, and GII.23.

### Claim 15 (depends on 9, 11)

The method of claim 9 or 11, further comprising contacting the stool sample with a nucleic acid probe that is capable of specifically hybridizing to a segment of the Norovirus genogroup II (GII) target nucleic acid sequence of SEQ ID NO: 4 or a complement thereof, wherein the nucleic acid probe is detectably labeled and comprises 5′d ACGTGGGAGGGCGATCGCAATCT 3′ (SEQ ID NO: 11) or a complement thereof.

### Claim 16 (depends on 15)

The method of claim 15, wherein the nucleic acid probe is detectably labelled with FAM fluorophore.

### Claim 17 (depends on 1, 9)

The method of claim 1 or 9, further comprising contacting the stool sample with a control primer pair that amplifies a control target nucleic acid of SEQ ID NO: 12 or a complement thereof.

### Claim 18 (depends on 17)

The method of claim 17, wherein the control primer pair consists of a forward primer comprising 5′d CTCGTCGACAATGGCGGAA 3′ (SEQ ID NO: 13) and a reverse primer comprising 5′d TTCAGCGACCCCGTTAGC 3′ (SEQ ID NO: 14).

### Claim 19 (depends on 17)

The method of claim 17, further comprising contacting the stool sample with a control nucleic acid probe that specifically hybridizes to a segment of the control target nucleic acid or a complement thereof, wherein the control nucleic acid probe is detectably labeled and comprises 5′d GCTTGGGGCGACAGTCACGTCGC 3′ (SEQ ID NO: 15) or a complement thereof.

### Claim 20 (depends on 19)

The method of claim 19, wherein the control nucleic acid probe is detectably labelled with Q670 fluorophore.

### Claim 21 (depends on 1, 9)

The method of claim 1 or 9, wherein real-time RT-PCR amplification is performed in a direct amplification disc in concert with an integrated thermal cycler.

### Claim 22 (depends on 1, 9)

The method of claim 1 or 9, wherein the stool sample comprises unformed stool, formed stool, or a rectal swab stored in liquid Amies media.