RNA-guided human genome engineering
AssigneePresident and Fellows of Harvard College
InventorsGeorge M. Church, Prashant G. Mali, Luhan Yang
Life of this patent
Estimating the term…
Abstract
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
Claims36
A method of altering a eukaryotic cell comprising
- transfecting the eukaryotic cell with a nucleic acid encoding a guide RNA complementary to genomic DNA of the eukaryotic cell,
- transfecting the eukaryotic cell with a nucleic acid encoding a Cas9 enzyme that interacts with the guide RNA and cleaves the genomic DNA in a site specific manner,
- wherein the eukaryotic cell expresses the guide RNA and the Cas9 enzyme, the guide RNA binds to complementary genomic DNA and the Cas9 enzyme cleaves the genomic DNA in a site specific manner;
- wherein the guide RNA includes a guide sequence complementary to the genomic DNA and a gRNA scaffold sequence connected to the guide sequence and the gRNA scaffold sequence comprising the following nucleic acid sequence
- (SEQ ID NO:
- 46)
- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA
- ACUUGAAAAAGUGGCACCGAGUCGGUGC.
A method of modulating expression of genomic DNA in a eukaryotic cell comprising
- transfecting the eukaryotic cell with a nucleic acid encoding a guide RNA complementary to genomic DNA of the eukaryotic cell,
- transfecting the eukaryotic cell with a nucleic acid encoding a Cas9 protein having inactive nuclease domains that interacts with the guide RNA and binds to the genomic DNA in a site specific manner,
- wherein the eukaryotic cell expresses the guide RNA and the Cas9 protein,
- wherein the Cas9 protein having inactive nuclease domains includes a transcriptional activator or repressor domain attached thereto for modulating target nucleic acid expression in vivo,
- wherein the guide RNA and the Cas9 protein including the transcriptional activator or repressor domain co-localize to the genomic DNA and wherein the transcriptional activator or repressor domain modulates expression of the genomic DNA,
- wherein the guide RNA includes a guide sequence complementary to the genomic DNA and a gRNA scaffold sequence comprising the following nucleic acid sequence
- (SEQ ID NO:
- 46)
- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA
- ACUUGAAAAAGUGGCACCGAGUCGGUGC.
A method of targeting a Cas 9 protein to genomic DNA in a eukaryotic cell comprising
- transfecting the eukaryotic cell with a nucleic acid encoding a guide RNA complementary to genomic DNA of the eukaryotic cell,
- transfecting the eukaryotic cell with a nucleic acid encoding a Cas9 protein that interacts with the guide RNA to form a guide RNA/Cas 9 protein complex bound to the genomic DNA,
- wherein the eukaryotic cell expresses the guide RNA and the Cas9 protein,
- wherein the guide RNA includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence comprising the following nucleic acid sequence
- (SEQ ID NO:
- 46)
- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACU
- UGAAAAAGUGGCACCGAGUCGGUGC.
Dependencies are inferred from the claim text.