# US 11,439,658 B2 · Compositions and methods for suppressing MSUT2

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 11,439,658 B2
- Document ID: US11439658B2
- Status: Granted
- Kind: B2
- Application number: 16/383,178
- Filed: 2019-04-12
- Published: 2019-10-31
- Granted: 2022-09-13
- Earliest claimed: 2018-04-12
- Assignees: The United States Government as represented by the Department of Veterans Affairs; University of Washington
- Applicants: United States Government As Represented By The Department of Veterans Affairs; University of Washington
- Inventors: Brian Kraemer; Jeanna M. Wheeler; Pamela McMillan; Timothy J. Strovas; Jeremy Baker
- Web page: https://patentgrep.com/patent/US11439658B2

## CPC

- A61K 31/713: Double-stranded nucleic acids or oligonucleotides
- A01K 67/0276: Knock-out vertebrates
- A61K 9/0019: {Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner (non-active ingredients are additionally classified in A61K47/00)}
- A61K 31/26: Cyanate or isocyanate esters; Thiocyanate or isothiocyanate esters
- A61K 31/41: having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K 31/4745: condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines (yohimbine derivatives, vinblastine A61K31/475; ergoline derivatives A61K31/48)
- A61K 31/7105: Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
- C12N 9/22: Ribonucleases {[RNase]; Deoxyribonucleases [DNase]}
- C12N 9/222: {Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes}
- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- C12N 15/86: Viral vectors
- A01K 2217/075: inducing loss of function, i.e. knock out
- A01K 2227/105: Murine
- A01K 2267/0312: Animal model for Alzheimer's disease
- C12N 2310/14: interfering nucleic acids [NA]
- C12N 2310/20: involving clustered regularly interspaced short palindromic repeats [CRISPR]
- C12N 2740/15043: viral genome or elements thereof as genetic vector
- C12N 2750/14143: viral genome or elements thereof as genetic vector
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A01K: ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)

## Abstract

Described herein are compositions and methods for treating Alzheimer's disease or dementia. The compositions include mammalian suppressor of taupathy 2 inhibitors (MSUT2). The MSUT2 inhibitors can be small interfering RNAs, guide RNAs, or small molecules. The methods include reducing accumulation of phosphorylated and aggregated human tau.

## Claims

### Claim 1

A method of inhibiting expression of a MSUT2 polynucleotide in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.

### Claim 2

A method of reducing phosphorylated and aggregated human tau protein in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.

### Claim 3

A method of potentiating a neuroinflammatory response to a pathological tau protein in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.

### Claim 4

A method of decreasing astrocytosis or microgliosis in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.

### Claim 5

A method of reducing neuroinflammation in a subject in need thereof, the method comprising administering to the subject a mammalian suppressor of tauopathy 2 (MSUT2) inhibitor, wherein the MSUT2 inhibitor is a double stranded small interfering RNA (siRNA) consisting of first and second strands, wherein the first strand comprises AUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 10), AUGAUGCAAAGUGUACUAAACCAGAUU (SEQ ID NO: 11), AUGAUGCAAAGUGUACUAAACCAGAU (SEQ ID NO: 12), AUGAUGCAAAGUGUACUAAACCA (SEQ ID NO: 13), AUAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 14), or UAUGAUGCAAAGUGUACUAAACCAG (SEQ ID NO: 15) and the second strand is sufficiently complementary to the first strand and to MSUT2 mRNA to mediate RNA interference of MSUT2, and wherein the MSUT2 inhibitor is administered intravenously or intrathecally.