# US 11,299,734 B2 · RNA interference for the treatment of gain-of-function disorders

> Agents: this data is available as JSON from the patentgrep API and MCP server — see https://patentgrep.com/llms.txt

- Number: US 11,299,734 B2
- Document ID: US11299734B2
- Status: Granted
- Kind: B2
- Application number: 16/415,826
- Filed: 2019-05-17
- Published: 2020-01-23
- Granted: 2022-04-12
- Earliest claimed: 2003-09-12
- Assignees: University of Massachusetts
- Applicants: University of Massachusetts
- Inventors: Neil Aronin; Phillip D. Zamore
- Web page: https://patentgrep.com/patent/US11299734B2

## CPC

- C12N 15/113: Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)}
- A61K 48/005: {characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered}
- A61P 25/00: Drugs for disorders of the nervous system
- A61P 25/28: for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
- C07H 21/02: with ribosyl as saccharide radical
- C12N 5/06: {Animal cells or tissues; Human cells or tissues (preservation of excised living parts A01N1/10)}
- C12N 15/111: {General methods applicable to biologically active non-coding nucleic acids}
- C12N 2310/14: interfering nucleic acids [NA]
- C12N 2310/3515: Lipophilic moiety, e.g. cholesterol
- C12N 2310/531: Stem-loop; Hairpin
- C12N 2320/30: Special therapeutic applications
- C12N 2320/34: Allele or polymorphism specific uses
- C12N: MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA (microbiological testing media C12Q1/00)
- A61K: PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES (devices or methods specially adapted for bringing pharmaceutical products into particular physical or administering forms A61J3/00; chemical aspects of, or use of materials for deodorisation of air, for disinfection or sterilisation, or for bandages, dressings, absorbent pads or surgical articles A61L; soap compositions C11D)
- A61P: SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- C07H: SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS (derivatives of aldonic or saccharic acids C07C, C07D; aldonic acids, saccharic acids C07C59/105, C07C59/285; cyanohydrins C07C255/16; glycals C07D; compounds of unknown constitution C07G; polysaccharides, derivatives thereof C08B; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification C12N15/00; sugar industry C13)

## Abstract

The present invention relates to the discovery of an effective treatment for a variety of gain-of-function diseases, in particular, Huntington's disease (HD). The present invention utilizes RNA Interference technology (RNAi) against polymorphic regions in the genes encoding various gain-of-function mutant proteins resulting in an effective treatment for the gain-of-function disease.

## Claims

### Claim 1

A composition for treating or managing Huntington's disease, comprising an RNA silencing agent targeting UAAGAGAUGGGGACAGUACUUCAACGCUAGAAGAACA (SEQ ID NO: 43) of an Htt mRNA, such that RNA silencing of said mRNA occurs, wherein the RNA silencing agent comprises:
(i) an antisense strand or a variant thereof having sufficient complementarity to SEQ ID NO: 43 to direct target-specific cleavage or translational repression of the Htt mRNA;
(ii) a sense strand or a variant thereof that is substantially complementary to the antisense strand; and
(iii) wherein the sense and antisense strands are capable of annealing together.

### Claim 2 (depends on 1)

The composition of claim 1, wherein the RNA silencing agent comprises an engineered RNA precursor.

### Claim 3 (depends on 2)

The composition of claim 2, wherein the engineered RNA precursor is expressed by a vector.

### Claim 4 (depends on 3)

The composition of claim 3, wherein the vector comprises a viral vector, retroviral vector, expression cassette, or plasmid.

### Claim 5 (depends on 3)

The composition of claim 3, wherein the vector further comprises an RNA Polymerase III or RNA Polymerase II promoter.

### Claim 6 (depends on 5)

The composition of claim 5, wherein the RNA Polymerase III promoter comprises a U6 or H1 promoter.

### Claim 7 (depends on 3)

The composition of claim 3, wherein the engineered RNA precursor comprises at least one internal bulge.

### Claim 8 (depends on 2)

The composition of claim 2, wherein each strand of the engineered RNA precursor is between 15 and 50 base pairs in length.

### Claim 9 (depends on 1)

The composition of claim 1, wherein the RNA silencing agent is conjugated to a lipophilic moiety optionally comprising a cholesterol moiety.